version
PlantPromoterDB promoter information of J080064C23

Summary of Gene (J080064C23)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0768600        NCBI 
Gene model J080064C23  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 33260414-33261613)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
J080064C23                       5'->3' (+)
Promoter sequence





 
J075027M08          
J075061E06          
J075160M13          
J090011G22          
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J080064C23

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+33261776-88
TSS clone peakAclone+33261781-83

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAGGTGGGCCGGA+3326158033261591-284-273
 OsREG476AGGTGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG628 GGTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG564  GTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG542   TGGGCCGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG644    GGGCCGGA PPDB MotifGCCCA  PLACE Motif 
REGTCCGGGCC+3326160733261614-257-250
 OsREG633TCCGGGCC PPDB Motif  PLACE Motif 
REGTCTGGCCCGGCCCAAAC+3326164233261658-222-206
 OsREG638TCTGGCCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG616   GGCCCGGC       PPDB Motif  PLACE Motif 
 OsREG614    GCCCGGCC      PPDB Motif  PLACE Motif 
 OsREG538     CCCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG542      CCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG563       CGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG625        GGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG593         GCCCAAAC PPDB MotifGCCCA  PLACE Motif 
REGGGGTGGGCCCACCTG+3326170833261722-156-142
 OsREG600GGGTGGGC        PPDB MotifGCCCA  PLACE Motif 
 OsREG640  GTGGGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG628 GGTGGGCCCACC   PPDB MotifGCCCA  PLACE Motif 
 OsREG476      GCCCACCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG514       CCCACCTG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.