version
PlantPromoterDB promoter information of J080067B02

Summary of Gene (J080067B02)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0110100        NCBI 
Gene model J080067B02  
Description NONE  
#
#

Overview

Focused view (chromosome 5: 519280-520479)

Genome position     
from initiation codon
009-015-D08         
009-023-C09         
009-031-B11         
009-034-C02         
009-050-B08         
009-065-D12         
009-090-G08         
009-111-H07         
009-136-F12         
009-138-E06         
009-138-G12         
009-141-D08         
009-143-D01         
009-179-D09         
009-179-E03         
009-196-A09         
009-199-F04         
013-021-E05         
013-076-C04         
013-096-F06         
014-071-A05         
014-077-F09         
AK099779            
AK121142            
J013095A16          
J013111A17          
J013132G04          
J023077M04          
J065001B11          
J065001E11          
J065057G10          
J065057L08          
J065080E07          
J065087K10          
J065091M15          
J065167A15          
J075018F02          
J075063F20          
J075064F18          
J075066N19          
J075073I02          
J075080P17          
J075081F11          
J075085E03          
J075101G18          
J075149N08          
J075158I21          
J075161M20          
J075190F12          
J075194K16          
J080001E08          
J080001F21          
J080001H19          
J080001O15          
J080005I22          
J080006K23          
J080014D20          
J080014I05          
J080014K21          
J080017I24          
J080017K11          
J080018F11          
J080022L18          
J080024N23          
J080027J23          
J080029B14          
J080032F14          
J080032K19          
J080032O21          
J080033P17          
J080034I06          
J080039F24          
J080040O13          
J080042B02          
J080043E12          
J080043J15          
J080043N09          
J080052J08          
J080053K01          
J080053K19          
J080055J09          
J080058D07          
J080062F11          
J080063J24          
J080066H04          
J080066I09          
J080067N09          
J080068D22          
J080068K13          
J080069N19          
J080070D07          
J080070E05          
J080071G04          
J080077G05          
J080077O06          
J080085F05          
J080086E07          
J080089G16          
J080092K15          
J080094A08          
J080097A09          
J080097J07          
J090027N01          
J090081J05          
TSS from cDNA
TSS information
J080067B02                       5'->3' (+)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J080067B02

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakTclone+520220-60
TSS clone peakGclone+520247-33

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTGGCGTG+519967519974-313-306
 OsREG502GTGGCGTG PPDB Motif  PLACE Motif 
REGAGGTGGGCTTGG+520021520032-259-248
 OsREG476AGGTGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG462 GGTGGGCT    PPDB MotifGCCCA  PLACE Motif 
 OsREG427  GTGGGCTT   PPDB MotifGCCCA  PLACE Motif 
 OsREG496   TGGGCTTG  PPDB MotifGCCCA  PLACE Motif 
 OsREG519    GGGCTTGG PPDB MotifGCCCA  PLACE Motif 
REGTGCGGCCCATAT+520040520051-240-229
 OsREG643TGCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG618 GCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG490  CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG630   GGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG480    GCCCATAT PPDB MotifGCCCA  PLACE Motif 
REGAATTGGGCCAA+520059520069-221-211
 OsREG433AATTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG492 ATTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG659  TTGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG660   TGGGCCAA PPDB MotifGCCCA  PLACE Motif 
REGTGTCAGTG+520094520101-186-179
 OsREG510TGTCAGTG PPDB Motif  PLACE MotifTGAC 
REGGTGGGACCCG+520119520128-161-152
 OsREG650GTGGGACC   PPDB MotifGGGACCC  PLACE Motif 
 OsREG648 TGGGACCC  PPDB MotifGGGACCC  PLACE Motif 
 OsREG569  GGGACCCG PPDB MotifGGGACCC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.