version
PlantPromoterDB promoter information of J080067E15

Summary of Gene (J080067E15)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0328000        NCBI 
Gene model J080067E15  
Description NONE  
#
#

Overview

Focused view (chromosome 5: 15225190-15223991)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
J080067E15                       5'->3' (-)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J080067E15

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-15223572-132

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCTTCCT-1522354315223550-103-110
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGATCGGACGGCC-1522362315223634-183-194
 OsREG589GATCGGAC     PPDB Motif  PLACE Motif 
 OsREG484 ATCGGACG    PPDB Motif  PLACE Motif 
 OsREG545  TCGGACGG   PPDB Motif  PLACE Motif 
 OsREG562   CGGACGGC  PPDB Motif  PLACE Motif 
 OsREG624    GGACGGCC PPDB Motif  PLACE Motif 
REGGGCCGTCCGATC-1522364615223657-206-217
 OsREG624GGCCGTCC     PPDB Motif  PLACE Motif 
 OsREG562 GCCGTCCG    PPDB Motif  PLACE Motif 
 OsREG545  CCGTCCGA   PPDB Motif  PLACE Motif 
 OsREG484   CGTCCGAT  PPDB Motif  PLACE Motif 
 OsREG589    GTCCGATC PPDB Motif  PLACE Motif 
REGTCTGGCCCGTTCGGCCCG-1522367015223687-230-247
 OsREG638TCTGGCCC           PPDB MotifGCCCA  PLACE Motif 
 OsREG424   GGCCCGTT        PPDB MotifAAACG(C/G), ACGGGC, CCAACGG  PLACE Motif 
 OsREG642         TTCGGCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG568          TCGGCCCG PPDB MotifACGGGC  PLACE Motif 
REGTTTCGGCCCGGA-1522371315223724-273-284
 OsREG634TTTCGGCC     PPDB Motif  PLACE Motif 
 OsREG642 TTCGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG568  TCGGCCCG   PPDB MotifACGGGC  PLACE Motif 
 OsREG544   CGGCCCGG  PPDB Motif  PLACE Motif 
 OsREG633    GGCCCGGA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.