version
PlantPromoterDB promoter information of J080068H06

Summary of Gene (J080068H06)

Organism Oryza sativa  
Chromosome 6  
Locus Os06g0199300        NCBI 
Gene model J080068H06  
Description NONE  
#
#

Overview

Focused view (chromosome 6: 5045777-5044578)

Genome position     
from initiation codon
J065045H01          
J075177C22          
J090048F01          
J100066F17          
TSS from cDNA
TSS information
J080068H06                       5'->3' (-)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J080068H06

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-5045027-250

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCCACGCC-50450695045076-292-299
 OsREG636TCCACGCC PPDB Motif  PLACE Motif 
REGGTGGTGGGCCCCACCCG-50450785045094-301-317
 OsREG527GTGGTGGG          PPDB MotifGCCCA  PLACE Motif 
 OsREG599 TGGTGGGC         PPDB MotifGCCCA  PLACE Motif 
 OsREG628  GGTGGGCC        PPDB MotifGCCCA  PLACE Motif 
 OsREG640   GTGGGCCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG647    TGGGCCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG641     GGGCCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG631      GGCCCCAC    PPDB Motif  PLACE Motif 
 OsREG612       GCCCCACC   PPDB Motif  PLACE Motif 
 OsREG528         CCCACCCG PPDB MotifGCCCA  PLACE Motif 
REGGGCCCCACGTGTCC-50451265045139-349-362
 OsREG631GGCCCCAC       PPDB Motif  PLACE Motif 
 OsREG572 GCCCCACG      PPDB Motif  PLACE Motif 
 OsREG450  CCCCACGT     PPDB MotifACGT  PLACE Motif 
 OsREG508   CCCACGTG    PPDB MotifACGT  PLACE Motif 
 OsREG434    CCACGTGT   PPDB MotifACGT  PLACE Motif 
 OsREG509     CACGTGTC  PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG451      ACGTGTCC PPDB MotifACGT  PLACE MotifACGTGKC 
REGCACTGACATGTGGGCCCT-50451495045166-372-389
 OsREG510CACTGACA           PPDB Motif  PLACE MotifTGAC 
 OsREG627        TGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG640         GTGGGCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG475          TGGGCCCT PPDB MotifGCCCA  PLACE Motif 
REGACGTGGGCCTC-50452305045240-453-463
 OsREG449ACGTGGGC    PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 
 OsREG571 CGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG472  GTGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG587   TGGGCCTC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.