version
PlantPromoterDB promoter information of J080069C15

Summary of Gene (J080069C15)

Organism Oryza sativa  
Chromosome 4  
Locus Os04g0635800        NCBI 
Gene model J080069C15  
Description NONE  
#
#

Overview

Focused view (chromosome 4: 32741856-32740657)

Genome position     
from initiation codon
006-033-E07         
011-067-A08         
AK060110            
AK099507            
AK104741            
AK120021            
J013029B17          
J013134M07          
J013149N18          
J013153L10          
J033131F08          
J043010E02          
J065031J05          
J065031J06          
J075030K04          
J075178K05          
J080001B10          
J080003N19          
J080005F20          
J080005G16          
J080007N02          
J080009J04          
J080017D04          
J080020M22          
J080021A15          
J080021F21          
J080023P05          
J080024P22          
J080027C20          
J080029K03          
J080035M18          
J080039F22          
J080039J03          
J080039L03          
J080039P14          
J080042E12          
J080047D19          
J080047M21          
J080049N03          
J080056J12          
J080060B10          
J080062K08          
J080064L07          
J080074H06          
J080086O14          
J080090C20          
J080090L14          
J080095G08          
J080097C07          
J090011F03          
J090082O17          
TSS from cDNA
TSS information
J080069C15                       5'->3' (-)
Promoter sequence













 
AK070546            
AY935255            
J023054N24          
J075134M24          
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J080069C15

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-32740931-75
TSS clone peakGclone-32740928-72

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCCCCTCCT-3274097232740981-116-125
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCACGGCCCGTT-3274100832741018-152-162
 OsREG504CACGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG446 ACGGCCCG   PPDB MotifACGGGC  PLACE Motif 
 OsREG424   GGCCCGTT PPDB MotifAAACG(C/G), ACGGGC, CCAACGG  PLACE Motif 
REGAATGGGCCGGCCCATCAAGGCCCATTA-3274104932741075-193-219
 OsREG431AATGGGCC          GGCCCATT  PPDB MotifGCCCA  PLACE Motif 
 OsREG490 ATGGGCCGGCCCAT             PPDB MotifGCCCA  PLACE Motif 
 OsREG615   GGGCCGGCCC               PPDB MotifGCCCA  PLACE Motif 
 OsREG542  TGGGCCGGCCCA              PPDB MotifGCCCA  PLACE Motif 
 OsREG590        GGCCCATC            PPDB MotifGCCCA  PLACE Motif 
 OsREG607         GCCCATCA           PPDB MotifGCCCA  PLACE Motif 
 OsREG497               CAAGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG430                AAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG474                 AGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG610                   GCCCATTA PPDB MotifGCCCA  PLACE Motif 
REGGGAGTGGG-3274111232741119-256-263
 OsREG532GGAGTGGG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.