version
PlantPromoterDB promoter information of J080070D22

Summary of Gene (J080070D22)

Organism Oryza sativa  
Chromosome 6  
Locus Os06g0567000        NCBI 
Gene model J080070D22  
Description NONE  
#
#

Overview

Focused view (chromosome 6: 22759015-22760214)

Genome position     
from initiation codon
009-166-G12         
AK121337            
J013122F01          
J023080N12          
J023120F03          
J065013B18          
J065039P21          
J065089E06          
J065095N19          
J065119H03          
J065121D18          
J065149G04          
J075012J04          
J075021G13          
J075106I23          
J075107F19          
J075152J22          
J075186J20          
J075188F16          
J080001G06          
J080002O09          
J080006E10          
J080006F24          
J080012L07          
J080016A10          
J080017D11          
J080017I04          
J080017I10          
J080020P06          
J080024A20          
J080027B10          
J080027E03          
J080027I01          
J080027K20          
J080041L12          
J080043D21          
J080044K11          
J080048I08          
J080049M12          
J080050C14          
J080050N21          
J080053F04          
J080054O16          
J080058O21          
J080059M11          
J080061A11          
J080063B15          
J080063F22          
J080066M18          
J080068D12          
J080071B06          
J080072B17          
J080081O04          
J080089H05          
J080093K13          
J080095I05          
J080097F19          
J080304C03          
J080304H11          
J080308M21          
J080313O15          
J090020N23          
J100023C12          
TSS from cDNA
TSS information
J080070D22                       5'->3' (+)
Promoter sequence













 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J080070D22

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+22759933-82

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTCCTCCCCC+2275992122759932-94-83
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGCGACGC+2275973722759744-278-271
 OsREG556CGCGACGC PPDB Motif  PLACE MotifCGACG 
REGGGGCCGGCCC+2275976422759773-251-242
 OsREG615GGGCCGGCCC PPDB MotifGCCCA  PLACE Motif 
REGCAAGGCCCAACA+2275978222759793-233-222
 OsREG497CAAGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG430 AAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG471  AGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG626   GGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG594    GCCCAACA PPDB MotifGCCCA  PLACE Motif 
REGCCCACCTGTTGGGCCGGGCCCACT+2275980522759828-210-187
 OsREG514CCCACCTG                 PPDB MotifGCCCA  PLACE Motif 
 OsREG436 CCACCTGT                PPDB Motif  PLACE Motif 
 OsREG594      TGTTGGGC           PPDB MotifGCCCA  PLACE Motif 
 OsREG626       GTTGGGCC          PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG563        TTGGGCCG         PPDB MotifGCCCA  PLACE Motif 
 OsREG542         TGGGCCGG        PPDB MotifGCCCA  PLACE Motif 
 OsREG538          GGGCCGGG       PPDB MotifGCCCA  PLACE Motif 
 OsREG614           GGCCGGGC      PPDB Motif  PLACE Motif 
 OsREG616            GCCGGGCC     PPDB Motif  PLACE Motif 
 OsREG543             CCGGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG566              CGGGCCCA   PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG640               GGGCCCAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG478                GGCCCACT PPDB MotifGCCCA  PLACE Motif 
REGATCCAACGGCCCACGGG+2275987022759886-145-129
 OsREG481ATCCAACG          PPDB MotifCCAACGG  PLACE Motif 
 OsREG548 TCCAACGG         PPDB MotifCCAACGG  PLACE Motif 
 OsREG518  CCAACGGC        PPDB MotifCCAACGG  PLACE Motif 
 OsREG494   CAACGGCC       PPDB MotifCCAACGG  PLACE Motif 
 OsREG423    AACGGCCC      PPDB MotifGCCCA, AAACG(C/G)  PLACE Motif 
 OsREG445     ACGGCCCA     PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG564      CGGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG571       GGCCCACG   PPDB MotifGCCCA  PLACE Motif 
 OsREG547        GCCCACGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG531         CCCACGGG PPDB MotifGCCCA, ACGGGC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.