version
PlantPromoterDB promoter information of J080077B16

Summary of Gene (J080077B16)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0488900        NCBI 
Gene model J080077B16  
Description NONE  
#
#

Overview

Focused view (chromosome 5: 24074048-24075247)

Genome position     
from initiation codon
013-076-E12         
AK071883            
AK073699            
AK105459            
J080009C06          
J080021N09          
J080041K24          
J080058H15          
J080064P06          
TSS from cDNA
TSS information
J080077B16                       5'->3' (+)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J080077B16

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+24074934-114

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCCTCCCTCCCCT+2407494924074963-99-85
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTTTGGGCCTAAAATGGGCCATACATGGGCCGGA+2407479124074824-257-224
 OsREG592TTTTGGGC                           PPDB MotifGCCCA  PLACE Motif 
 OsREG625 TTTGGGCC                          PPDB MotifGCCCA  PLACE Motif 
 OsREG471  TTGGGCCT                         PPDB MotifGCCCA  PLACE Motif 
 OsREG656   TGGGCCTA                        PPDB MotifGCCCA  PLACE Motif 
 OsREG422           AAATGGGC                PPDB MotifGCCCA  PLACE Motif 
 OsREG431            AATGGGCC               PPDB MotifGCCCA  PLACE Motif 
 OsREG488             ATGGGCCA              PPDB MotifGCCCA  PLACE Motif 
 OsREG487              TGGGCCAT             PPDB MotifGCCCA  PLACE Motif 
 OsREG437                      ACATGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG517                       CATGGGCC    PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG490                        ATGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG542                         TGGGCCGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG644                          GGGCCGGA PPDB MotifGCCCA  PLACE Motif 
REGCCCGGCCCATAC+2407482624074837-222-211
 OsREG538CCCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG542 CCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG490  CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG630   GGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG606    GCCCATAC PPDB MotifGCCCA  PLACE Motif 
REGTGCGGCCCACAC+2407486424074875-184-173
 OsREG643TGCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG618 GCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG564  CGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG627   GGCCCACA  PPDB MotifGCCCA  PLACE Motif 
 OsREG598    GCCCACAC PPDB MotifGCCCA  PLACE Motif 
REGCTGGCCCATG+2407488424074893-164-155
 OsREG577CTGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG488 TGGCCCAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG517  GGCCCATG PPDB MotifGCCCA, CCATGG  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.