version
PlantPromoterDB promoter information of J080077M11

Summary of Gene (J080077M11)

Organism Oryza sativa  
Chromosome 12  
Locus Os12g0578500        NCBI 
Gene model J080077M11  
Description NONE  
#
#

Overview

Focused view (chromosome 12: 24145643-24144444)

Genome position     
from initiation codon
AK065485            
J043027D21          
J075120F12          
J080010J21          
J080015L10          
J080016C19          
J080016F10          
J080022A12          
J080024B10          
J080025C16          
J080026B03          
J080028B11          
J080028M19          
J080030I02          
J080032F18          
J080038O16          
J080040D01          
J080043H19          
J080045N21          
J080046H14          
J080053B20          
J080053P14          
J080056L15          
J080057F14          
J080060C10          
J080061D20          
J080061J12          
J080062F17          
J080065M15          
J080066N15          
J080069K21          
J080070L14          
J080072L05          
J080072L16          
J080075D08          
J080075I19          
J080076M24          
J080078O10          
J080081K24          
J080082J02          
J080083N20          
J080085M09          
J080093K05          
J080094J19          
J080095E06          
J080096B04          
J080096H08          
J090034I21          
J090045J19          
J090065F20          
J100077M24          
TSS from cDNA
TSS information
J080077M11                       5'->3' (-)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J080077M11

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakTclone-24145108-465

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCCTCTT-2414510524145113-462-470
Y PatchCCCTTCTCCTCCTCTT-2414513924145154-496-511
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGGGCTGGG-2414527024145278-627-635
 OsREG523TGGGCTGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG533 GGGCTGGG PPDB MotifGCCCA  PLACE Motif 
REGACACGTGGGC-2414528124145290-638-647
 OsREG434ACACGTGG   PPDB MotifACGT  PLACE Motif 
 OsREG508 CACGTGGG  PPDB MotifACGT  PLACE Motif 
 OsREG449  ACGTGGGC PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.