version
PlantPromoterDB promoter information of J080079E23

Summary of Gene (J080079E23)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0796600        NCBI 
Gene model J080079E23  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 34020420-34021619)

Genome position     
from initiation codon
003-113-D10         
011-076-B12         
AK105257            
J075105C03          
J080036O17          
J080064E16          
J080069E03          
J090036H20          
J100029L10          
J100055G09          
TSS from cDNA
TSS information
J080079E23                       5'->3' (+)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J080079E23

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone+34020541-879

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCCTCCC+3402052334020530-897-890
Y PatchCTCCTCTC+3402053834020545-882-875
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCATCCACC+3402024734020254-1173-1166
 OsREG515CATCCACC PPDB Motif  PLACE Motif 
REGCCCACTCT+3402027234020279-1148-1141
 OsREG455CCCACTCT PPDB Motif  PLACE Motif 
REGCAACGGCC+3402036834020375-1052-1045
 OsREG494CAACGGCC PPDB MotifCCAACGG  PLACE Motif 
REGTGAGGGACGCGTGTCCCTCA+3402038834020407-1032-1013
 OsREG442    GGACGCGT         PPDB Motif  PLACE Motif 
 OsREG652TGAGGGAC    GTCCCTCA PPDB MotifGGGACCC  PLACE Motif 
REGCGCCACGT+3402043634020443-984-977
 OsREG448CGCCACGT PPDB MotifACGT  PLACE MotifACGTGKC 
REGCCCGGGCCCAGCGCACCGCCACGTC+3402045634020480-964-940
 OsREG539CCCGGGCC                  PPDB Motif  PLACE Motif 
 OsREG543 CCGGGCCC                 PPDB MotifGCCCA  PLACE Motif 
 OsREG566  CGGGCCCA                PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG579   GGGCCCAG               PPDB MotifGCCCA  PLACE Motif 
 OsREG620    GGCCCAGC              PPDB MotifGCCCA  PLACE Motif 
 OsREG554           CGCACCGC       PPDB Motif  PLACE Motif 
 OsREG448                CGCCACGT  PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG585                 GCCACGTC PPDB MotifACGT  PLACE MotifACGTGKC 
REGTCGTGGGCCCCACC+3402048234020495-938-925
 OsREG601TCGTGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG571 CGTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG640  GTGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG647   TGGGCCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG641    GGGCCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG631     GGCCCCAC  PPDB Motif  PLACE Motif 
 OsREG612      GCCCCACC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.