version
PlantPromoterDB promoter information of J080085O11

Summary of Gene (J080085O11)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0101500        NCBI 
Gene model J080085O11  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 81644-80445)

Genome position     
from initiation codon
009-015-D06         
012-006-E03         
012-093-C06         
013-006-A02         
013-011-F03         
AK067642            
AK072105            
J013027G04          
J013034P10          
J013039D15          
J013048P14          
J013050O03          
J013056H19          
J013071D11          
J013097D17          
J013104F13          
J013108J23          
J013119J12          
J013122N16          
J013146M24          
J013149E16          
J013157E04          
J023012P06          
J023050C21          
J023057K22          
J023107F18          
J023110B19          
J023111H01          
J023148P04          
J043009E13          
J043009H22          
J065007D17          
J065038K16          
J065042A01          
J065075C20          
J065091I04          
J065131A03          
J075152O18          
J075152P17          
J080001F06          
J080002H09          
J080004L23          
J080005H18          
J080010D22          
J080010G17          
J080013E07          
J080013P18          
J080015D22          
J080025H24          
J080026O03          
J080036J01          
J080036L03          
J080037O13          
J080041D10          
J080045J04          
J080046J06          
J080048G16          
J080048I21          
J080056F16          
J080056L16          
J080057C02          
J080058D03          
J080061B19          
J080061E16          
J080061L22          
J080062P08          
J080067C01          
J080067G13          
J080068F20          
J080072H15          
J080072P12          
J080079O21          
J080081J15          
J080081K02          
J080086N15          
J080087E22          
J080087O15          
J080091D07          
J080091J02          
J080091L21          
J080093B13          
J100069F01          
J100086B08          
TSS from cDNA
TSS information
J080085O11                       5'->3' (-)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J080085O11

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-82880-636

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATTTGGGCCCC-8297282982-728-738
 OsREG493ATTTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG625 TTTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG639  TTGGGCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG647   TGGGCCCC PPDB MotifGCCCA  PLACE Motif 
REGGCCACACG-8298682993-742-749
 OsREG573GCCACACG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.