version
PlantPromoterDB promoter information of J080088P07

Summary of Gene (J080088P07)

Organism Oryza sativa  
Chromosome 8  
Locus Os08g0130500        NCBI 
Gene model J080088P07  
Description NONE  
#
#

Overview

Focused view (chromosome 8: 1724912-1723713)

Genome position     
from initiation codon
AK100956            
J013036D06          
J013039D01          
J013049M20          
J013112B20          
J013153L14          
J023013N01          
J023025K17          
J023028I05          
J023056H02          
J023078L07          
J023083L20          
J023105M17          
J023126C03          
J023140F10          
J033031G22          
J033040M20          
J033042F16          
J033073P06          
J033090J06          
J033115L03          
J033121E17          
J033121N23          
J043017E06          
J065097E02          
J090004D11          
J090004K19          
J090015E21          
J090038B03          
J090039E04          
J090085C18          
J090085L11          
J090087G21          
J090094P17          
J090095G12          
J090095I04          
J100017M16          
J100081J15          
TSS from cDNA
TSS information
J080088P07                       5'->3' (-)
Promoter sequence

 
J075011B02          
J075034I16          
J075135A12          
J075177B07          
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J080088P07

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-1722140-128

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCCACTATAAATA-17221671722178-155-166
Y PatchCTCCTCCTC-17220931722101-81-89
Y PatchTCCCTCTC-17221791722186-167-174
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCAAGCCCATCAGGCCCACCAAC-17222021722224-190-212
 OsREG519CCAAGCCC                PPDB MotifGCCCA  PLACE Motif 
 OsREG496 CAAGCCCA               PPDB MotifGCCCA  PLACE Motif 
 OsREG429  AAGCCCAT              PPDB MotifGCCCA  PLACE Motif 
 OsREG466   AGCCCATC             PPDB MotifGCCCA  PLACE Motif 
 OsREG607    GCCCATCA            PPDB MotifGCCCA  PLACE Motif 
 OsREG646         TCAGGCCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG513          CAGGCCCA      PPDB MotifGCCCA  PLACE Motif 
 OsREG472           AGGCCCAC     PPDB MotifGCCCA  PLACE Motif 
 OsREG628            GGCCCACC    PPDB MotifGCCCA  PLACE Motif 
 OsREG599             GCCCACCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG520               CCACCAAC PPDB MotifCCAACGG  PLACE Motif 
REGAGCCCAATAAGGCCCATCT-17222571722275-245-263
 OsREG460AGCCCAAT            PPDB MotifGCCCA  PLACE Motif 
 OsREG596 GCCCAATA           PPDB MotifGCCCA  PLACE Motif 
 OsREG430        AAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG474         AGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG590          GGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG456           GCCCATCT PPDB MotifGCCCA  PLACE Motif 
REGCAAGGCCCATAC-17222831722294-271-282
 OsREG497CAAGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG430 AAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG474  AGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG630   GGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG606    GCCCATAC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.