version
PlantPromoterDB promoter information of J080095G03

Summary of Gene (J080095G03)

Organism Oryza sativa  
Chromosome 8  
Locus Os08g0200300        NCBI 
Gene model J080095G03  
Description NONE  
#
#

Overview

Focused view (chromosome 8: 5808250-5807051)

Genome position     
from initiation codon
005-007-C01         
009-041-H05         
009-055-G10         
009-101-E05         
009-110-H11         
009-114-D06         
009-116-B08         
009-125-H04         
009-131-H10         
009-136-F02         
009-144-C04         
009-149-E10         
009-189-G08         
AK105055            
AK121083            
J013051F20          
J013060E15          
J013070F24          
J013071K15          
J013091E11          
J013134L03          
J023063I15          
J023084E22          
J023084J06          
J033090D12          
J065001D08          
J065007K04          
J065040H06          
J065078N14          
J065093B19          
J065103D10          
J065107E16          
J065116E01          
J065129B10          
J065132F08          
J065135M15          
J065149C13          
J065155H23          
J065162P16          
J065169P09          
J065176B09          
J065187F07          
J065194H08          
J065197G22          
J065208D12          
J065210B17          
J065219D24          
J075009C14          
J075009O22          
J075012J06          
J075014G03          
J075015A03          
J075022B09          
J075023H11          
J075025J07          
J075026K15          
J075029D06          
J075038G19          
J075041N03          
J075048P22          
J075051J23          
J075051L15          
J075052P04          
J075058O21          
J075062E03          
J075063K18          
J075064K01          
J075067B03          
J075070I20          
J075071J04          
J075074F17          
J075076H02          
J075080E17          
J075081F04          
J075086K17          
J075090I07          
J075092F21          
J075096P11          
J075099K15          
J075102M12          
J075105B03          
J075110I07          
J075111C15          
J075111M09          
J075114I06          
J075115E15          
J075123K17          
J075125B03          
J075126A12          
J075129L20          
J075130B11          
J075137J12          
J075141G10          
J075141I06          
J075143A22          
J075148E07          
J075158D09          
J075168G18          
J075169K08          
J075170A10          
J075170E18          
J075179C15          
J075180L24          
J075181A22          
J075185C20          
J075191B07          
J075192D03          
J075192L04          
J075193G10          
J075193M18          
J075198F05          
J080001F14          
J080001J20          
J080002N10          
J080003I15          
J080004H05          
J080006J08          
J080007D08          
J080008B21          
J080009P16          
J080010F24          
J080011F18          
J080012J03          
J080013B21          
J080013N24          
J080017D22          
J080017E04          
J080018G06          
J080020M24          
J080021C22          
J080021E21          
J080021G12          
J080021N20          
J080022B02          
J080022D19          
J080024J07          
J080026M20          
J080028D11          
J080029E08          
J080030F06          
J080030J09          
J080032F19          
J080032L09          
J080032O15          
J080034J07          
J080035A04          
J080035A12          
J080037P21          
J080040F18          
J080040N13          
J080040P12          
J080041E09          
J080044A04          
J080044F21          
J080044P20          
J080045N06          
J080046H12          
J080047A12          
J080047O03          
J080047O20          
J080048G24          
J080049H08          
J080050G23          
J080050P05          
J080052J24          
J080056N20          
J080056O04          
J080058D10          
J080058G13          
J080059H10          
J080062G11          
J080064A12          
J080064E18          
J080064O19          
J080065F09          
J080065P22          
J080067A17          
J080067E09          
J080069M22          
J080070E21          
J080070K18          
J080071L21          
J080071P04          
J080072M02          
J080075K15          
J080075K19          
J080076L03          
J080079L23          
J080080O08          
J080081H06          
J080082L22          
J080083N23          
J080084J09          
J080085B01          
J080087M23          
J080088P08          
J080090A20          
J080092J18          
J080097C14          
J080097P20          
J080301E13          
J080301G11          
J080301I11          
J080301O21          
J080302L09          
J080303E17          
J080304C05          
J080305E22          
J080305F22          
J080307B14          
J080310B22          
J080310J02          
J080312N01          
J080313I10          
J080315K16          
J080317B08          
J080317H10          
J080317M14          
J080317P17          
J080319M22          
J090052E23          
J090071I04          
J100045L08          
J100068N19          
U86018              
TSS from cDNA
TSS information
J080095G03                       5'->3' (-)
Promoter sequence




 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J080095G03

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-5807329-79

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCCATCCACC-58074035807412-153-162
 OsREG534CCCATCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG515  CATCCACC PPDB Motif  PLACE Motif 
REGCGCCACGTGGCG-58074545807465-204-215
 OsREG507 GCCACGTGGC  PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG448CGCCACGTGGCG PPDB MotifACGT  PLACE MotifACGTGKC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.