version
PlantPromoterDB promoter information of J080095G04

Summary of Gene (J080095G04)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0119300        NCBI 
Gene model J080095G04  
Description NONE  
#
#

Overview

Focused view (chromosome 5: 981017-979818)

Genome position     
from initiation codon
004-011-B09         
006-063-A03         
006-077-E12         
006-079-E12         
006-100-B11         
009-109-A12         
009-123-C07         
009-163-D09         
009-170-D11         
009-173-C01         
009-192-E01         
011-048-G01         
AK060883            
AK068289            
AK071554            
AK099495            
AY348312            
J013037L16          
J013088P04          
J013099D14          
J013146E19          
J013147E18          
J023104E19          
J023128O20          
J023132D16          
J023143E13          
J033028F15          
J033133D24          
J053091M07          
J075029L15          
J075097M12          
J075103J11          
J075138J10          
J075172K18          
J080001C15          
J080002M13          
J080009K01          
J080010N01          
J080011D23          
J080013C13          
J080013M16          
J080018J02          
J080020F03          
J080020G05          
J080021D05          
J080030A19          
J080031A16          
J080033J23          
J080035H07          
J080039M24          
J080042B16          
J080043B03          
J080045G01          
J080045K17          
J080047A09          
J080047I22          
J080048M14          
J080049J02          
J080052C15          
J080052E11          
J080052M22          
J080056O21          
J080059J04          
J080059O17          
J080064N04          
J080066A03          
J080066I22          
J080069C13          
J080069J03          
J080069N04          
J080071A01          
J080071C03          
J080071J02          
J080080D17          
J080084O06          
J080085O20          
J080086H15          
J080094K06          
J080095C05          
J080096F03          
J080096F20          
J090004H05          
J090012P10          
J090021B09          
J090034M08          
J090046G21          
J090055K24          
J090055L05          
J090057H17          
J090082K21          
J100022A07          
J100022M02          
J100069K11          
J100086C24          
TSS from cDNA
TSS information
J080095G04                       5'->3' (-)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J080095G04

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakTclone-980800-783
TSS clone peakGclone-980799-782

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCTCCTATATAG-980826980836-809-819
Y PatchTCTTCCTCCTC-980750980760-733-743
Y PatchTCCTTCCTCCC-980773980783-756-766
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGACGTGGC-980840980847-823-830
 OsREG585GACGTGGC PPDB MotifACGT  PLACE MotifACGTGKC 
REGAGTGACAC-980854980861-837-844
 OsREG477AGTGACAC PPDB Motif  PLACE MotifTGAC 
REGGCTGGGCCCCACGCG-980864980878-847-861
 OsREG620GCTGGGCC        PPDB MotifGCCCA  PLACE Motif 
 OsREG579 CTGGGCCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG647  TGGGCCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG641   GGGCCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG631    GGCCCCAC    PPDB Motif  PLACE Motif 
 OsREG572     GCCCCACG   PPDB Motif  PLACE Motif 
 OsREG530       CCCACGCG PPDB MotifGCCCA  PLACE Motif 
REGGTCCCACC-980885980892-868-875
 OsREG651GTCCCACC PPDB MotifGGGACCC  PLACE Motif 
REGCTCGCGCGTCTCCATGGGCCCCACATGTCAGTG-980926980958-909-941
 OsREG558CTCGCGCG                          PPDB MotifACGCGC  PLACE Motif 
 OsREG560    CGCGTCTC                      PPDB Motif  PLACE Motif 
 OsREG525           CCATGGGC               PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG517            CATGGGCC              PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG489             ATGGGCCC             PPDB MotifGCCCA  PLACE Motif 
 OsREG647              TGGGCCCC            PPDB MotifGCCCA  PLACE Motif 
 OsREG641               GGGCCCCA           PPDB MotifGCCCA  PLACE Motif 
 OsREG631                GGCCCCAC          PPDB Motif  PLACE Motif 
 OsREG611                 GCCCCACA         PPDB Motif  PLACE Motif 
 OsREG510                         TGTCAGTG PPDB Motif  PLACE MotifTGAC 
REGGGCCCCACC-981048981056-1031-1039
 OsREG631GGCCCCAC  PPDB Motif  PLACE Motif 
 OsREG612 GCCCCACC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.