version
PlantPromoterDB promoter information of J080097O04

Summary of Gene (J080097O04)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0823600        NCBI 
Gene model J080097O04  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 36263582-36262383)

Genome position     
from initiation codon
AK070498            
J065055C02          
J065098A17          
J065119B13          
J065146F10          
J065209G06          
J080001K12          
J080004O17          
J080005P21          
J080009M18          
J080013O18          
J080014B04          
J080014O21          
J080015B04          
J080016B17          
J080017G09          
J080022A17          
J080024M10          
J080025F17          
J080025O16          
J080029H09          
J080030G24          
J080031E02          
J080032A18          
J080032G24          
J080033C05          
J080033N19          
J080035H10          
J080035L05          
J080042N09          
J080044C14          
J080048K16          
J080050L07          
J080051L06          
J080051P22          
J080053D09          
J080053J15          
J080053O12          
J080057L01          
J080062E08          
J080062I09          
J080063A21          
J080063E04          
J080063E08          
J080064D15          
J080064N15          
J080068F13          
J080070L16          
J080072O17          
J080075A07          
J080076H10          
J080077K19          
J080078E19          
J080082A02          
J080083O05          
J080091I07          
J080094K10          
J080094N03          
J080096F09          
J090037B19          
J100017A13          
J100068N22          
J100072C06          
TSS from cDNA
TSS information
J080097O04                       5'->3' (-)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J080097O04

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-36262680-98

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCTTCCTTCCTTCCTCC-3626269736262714-115-132
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCCGGCCCAAA-3626275336262763-171-181
 OsREG644TCCGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG542 CCGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG563  CGGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG625   GGCCCAAA PPDB MotifGCCCA  PLACE Motif 
REGAGTTGGGCCGTTGG-3626278336262796-201-214
 OsREG479AGTTGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG626 GTTGGGCC      PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG563  TTGGGCCG     PPDB MotifGCCCA  PLACE Motif 
 OsREG445   TGGGCCGT    PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG423    GGGCCGTT   PPDB MotifGCCCA, AAACG(C/G)  PLACE Motif 
 OsREG494     GGCCGTTG  PPDB MotifCCAACGG  PLACE Motif 
 OsREG518      GCCGTTGG PPDB MotifCCAACGG  PLACE Motif 
REGTCCGGCCCATTT-3626279936262810-217-228
 OsREG644TCCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG542 CCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG490  CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG431   GGCCCATT  PPDB MotifGCCCA  PLACE Motif 
 OsREG422    GCCCATTT PPDB MotifGCCCA  PLACE Motif 
REGCAGGCCCATGA-3626283136262841-249-259
 OsREG513CAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG474 AGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG517  GGCCCATG  PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG609   GCCCATGA PPDB MotifGCCCA  PLACE Motif 
REGTAATGGGCCGC-3626287736262887-295-305
 OsREG610TAATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG431 AATGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG490  ATGGGCCG  PPDB MotifGCCCA  PLACE Motif 
 OsREG618   TGGGCCGC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.