version
PlantPromoterDB promoter information of J080306J16

Summary of Gene (J080306J16)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0685500        NCBI 
Gene model J080306J16  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 28108040-28106841)

Genome position     
from initiation codon
009-034-F03         
009-081-B02         
AB110171            
AK062080            
AK111863            
AK120726            
J013099K19          
J023002L22          
J023052G18          
J023057J22          
J023095A10          
J033024B20          
J033097N07          
J033120G20          
J033132H15          
J053032B21          
J053050E18          
J053062E18          
J053080L14          
J065016K08          
J065064M10          
J065069C22          
J065202I16          
J065214M17          
J075007E07          
J075016A20          
J075036C08          
J075057C03          
J075064H21          
J075078B13          
J075078D01          
J075087P03          
J075091N16          
J075110P14          
J075116J17          
J075148J23          
J075171C20          
J075175K20          
J080035F24          
J080058E06          
J080086E16          
J080301L22          
J080304O06          
J080305N09          
J080306N17          
J080311O12          
J080315L06          
J080317H12          
J080317O05          
J080318L22          
J090001K10          
J090006D01          
J090065J21          
J090070G13          
J090080J03          
J100028F03          
J100073D05          
TSS from cDNA
TSS information
J080306J16                       5'->3' (-)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J080306J16

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-28107136-96

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCGGCTATAAAAG-2810716328107174-123-134
Y PatchCCCCTCCT-2810709028107097-50-57
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCTGGCCCCACA-2810727528107286-235-246
 OsREG638TCTGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG631   GGCCCCAC  PPDB Motif  PLACE Motif 
 OsREG611    GCCCCACA PPDB Motif  PLACE Motif 
REGGGCCCCACA-2810730128107309-261-269
 OsREG631GGCCCCAC  PPDB Motif  PLACE Motif 
 OsREG611 GCCCCACA PPDB Motif  PLACE Motif 
REGTCCAACGGTC-2810736228107371-322-331
 OsREG548TCCAACGG   PPDB MotifCCAACGG  PLACE Motif 
 OsREG495  CAACGGTC PPDB MotifCCAACGG  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.