version
PlantPromoterDB promoter information of J080309B06

Summary of Gene (J080309B06)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0419800        NCBI 
Gene model J080309B06  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 14101289-14100090)

Genome position     
from initiation codon
AK062104            
AK066281            
J013022D04          
J013063L01          
J033072F14          
J033084J02          
J075129I10          
J075190C14          
J100019D11          
J100019H05          
J100027I20          
J100082E01          
J100087L08          
TSS from cDNA
TSS information
J080309B06                       5'->3' (-)
Promoter sequence







 
                    
Os07g0419900        
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J080309B06

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-14100352-63

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCGTCTATAAAAC-1410038014100391-91-102
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCTCGCCC-1410039314100400-104-111
 OsREG549CCTCGCCC PPDB MotifGCCCA  PLACE Motif 
REGGGACCCAC-1410057314100580-284-291
 OsREG622GGACCCAC PPDB MotifGGGACCC  PLACE Motif 
REGGAGGCGTGGGCCAC-1410060714100620-318-331
 OsREG503GAGGCGTG       PPDB Motif  PLACE Motif 
 OsREG602   GCGTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG571    CGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG654     GTGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG653      TGGGCCAC PPDB MotifGCCCA  PLACE Motif 
REGCCGTCGGAT-1410062314100631-334-342
 OsREG546CCGTCGGA  PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG483 CGTCGGAT PPDB MotifCCGAC  PLACE MotifCGACG 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.