version
PlantPromoterDB promoter information of J080316C05

Summary of Gene (J080316C05)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0529600        NCBI 
Gene model J080316C05  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 21383743-21384942)

Genome position     
from initiation codon
006-066-F05         
009-049-D10         
009-180-A06         
013-001-E04         
013-011-G03         
013-015-D04         
013-016-B02         
013-021-B11         
013-021-F07         
013-022-B02         
013-029-D10         
013-029-E04         
013-032-A07         
013-035-D07         
013-036-B03         
013-036-B10         
013-037-F08         
013-040-B02         
013-040-B10         
013-041-D07         
013-044-H10         
013-046-C06         
013-047-E03         
013-051-E06         
013-055-B07         
013-055-H04         
013-057-G06         
013-060-E04         
013-062-C07         
013-064-B11         
013-065-A09         
013-065-H03         
013-066-C07         
013-069-B03         
013-070-B08         
013-074-A03         
013-082-B08         
013-083-C10         
013-088-H12         
013-089-A10         
013-089-H06         
013-091-B09         
013-095-D09         
013-099-D03         
014-008-H04         
014-015-D12         
014-017-H12         
014-040-C05         
014-045-D07         
014-053-B03         
014-073-B05         
014-098-F10         
AB110170            
AK064916            
AK099918            
J013000M17          
J013039J16          
J013055B12          
J013059A13          
J013060H05          
J013067A05          
J013071H11          
J013075I24          
J013102B09          
J013123E11          
J013123I22          
J013123L17          
J013156A11          
J013158K17          
J013160E19          
J023022F22          
J023045D15          
J023063E21          
J023078H19          
J023107E18          
J023107O16          
J023108B07          
J023113M14          
J023122K02          
J023134I12          
J033024O07          
J033045E09          
J033050O12          
J033052B16          
J033052F10          
J033052L07          
J033055D16          
J033093C13          
J033107I04          
J033122D23          
J043029H01          
J065035I11          
J065087P10          
J065124B14          
J065198E12          
J065210N22          
J065210P16          
J080309H11          
J090039D18          
J090053F06          
J090084D01          
J090085K24          
J090096C10          
J100045M09          
TSS from cDNA
TSS information
J080316C05                       5'->3' (+)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J080316C05

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+21384739-4

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTATACCCC+2138471121384718-32-25
Y PatchCTCTCCTCTT+2138469621384705-47-38
Y PatchCTCTCCTC+2138475021384757714
Y PatchCTCCTCCTC+21384779213847873644
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGAGGCCCATAC+2138465021384660-93-83
 OsREG587GAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG474 AGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG630  GGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG606   GCCCATAC PPDB MotifGCCCA  PLACE Motif 
REGGACACGTGG+2138466521384673-78-70
 OsREG509GACACGTG  PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG434 ACACGTGG PPDB MotifACGT  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.