version
PlantPromoterDB promoter information of J080316L10

Summary of Gene (J080316L10)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0726100        NCBI 
Gene model J080316L10  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 30287071-30288270)

Genome position     
from initiation codon
004-005-B05         
006-023-C08         
006-029-H02         
006-032-B03         
006-035-C10         
006-040-H05         
006-043-C02         
006-046-B11         
006-046-E05         
006-046-H04         
006-048-A09         
006-050-A02         
006-063-A02         
006-064-A09         
006-070-G11         
006-072-G04         
006-077-G12         
006-080-F04         
006-080-H01         
006-084-D10         
006-084-G06         
006-085-H10         
006-086-C05         
006-087-D10         
006-096-C09         
006-100-F10         
006-108-D12         
006-115-G10         
006-119-C09         
006-120-E05         
011-042-H01         
011-075-B11         
013-003-D03         
013-028-B11         
013-031-A01         
013-035-F03         
013-051-D02         
013-055-D06         
013-059-H03         
013-076-A09         
013-076-B01         
013-087-C12         
013-090-F09         
013-100-A05         
013-100-F05         
013-100-G12         
014-006-G08         
015-003-B07         
016-093-C06         
AF030548            
AK102194            
AK119247            
AK119362            
AK119638            
J013066P16          
J023022H18          
J023087O13          
J023121I16          
J023123M09          
J033022M05          
J033087C05          
J065022K07          
J065024E22          
J065041G05          
J065045M11          
J065082K10          
J065121K18          
J065137O07          
J065144B12          
J065152E04          
J065159D24          
J065217E02          
J075014N22          
J075064O17          
J080318L20          
J090034D01          
J090034P05          
J090041H08          
J090042F20          
J090042I15          
J090044G24          
J090050O17          
J090054L13          
J090062A12          
J090068I22          
J090070J23          
J090070M18          
J090084L07          
J090087H13          
J090095H10          
J090099M17          
J100022O10          
J100048A05          
J100057O06          
X91806              
TSS from cDNA
TSS information
J080316L10                       5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J080316L10

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+30287946-125

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxGCCCTATAAAAC+3028790730287918-164-153
Y PatchCCTCTCTCC+3028798430287992-87-79
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCTGGACCCACCTGTCAGTG+3028768330287702-388-369
 OsREG649TCTGGACC             PPDB Motif  PLACE Motif 
 OsREG622   GGACCCAC          PPDB MotifGGGACCC  PLACE Motif 
 OsREG514      CCCACCTG       PPDB MotifGCCCA  PLACE Motif 
 OsREG436       CCACCTGT      PPDB Motif  PLACE Motif 
 OsREG501        CACCTGTC     PPDB Motif  PLACE Motif 
 OsREG551          CCTGTCAG   PPDB Motif  PLACE MotifTGAC 
 OsREG453           CTGTCAGT  PPDB Motif  PLACE MotifTGAC 
 OsREG510            TGTCAGTG PPDB Motif  PLACE MotifTGAC 
REGGACCGTTG+3028779430287801-277-270
 OsREG495GACCGTTG PPDB MotifCCAACGG  PLACE Motif 
REGCTCCCCCA+3028786130287868-210-203
 OsREG574CTCCCCCA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.