version
PlantPromoterDB promoter information of J080317O15

Summary of Gene (J080317O15)

Organism Oryza sativa  
Chromosome 8  
Locus Os08g0386300        NCBI 
Gene model J080317O15  
Description NONE  
#
#

Overview

Focused view (chromosome 8: 18312643-18311444)

Genome position     
from initiation codon
AK059323            
AK070379            
J023054P20          
J033089H01          
J065013I01          
J065212E17          
J090018O07          
TSS from cDNA
TSS information
J080317O15                       5'->3' (-)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J080317O15

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-18311960-317

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCTCCCC-1831196118311968-318-325
Y PatchCCTCCTCTTTCCCCTCT-1831198718312003-344-360
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGGTGGGCCCATG-1831201818312030-375-387
 OsREG599TGGTGGGC      PPDB MotifGCCCA  PLACE Motif 
 OsREG628 GGTGGGCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG640  GTGGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG489    GGGCCCAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG517     GGCCCATG PPDB MotifGCCCA, CCATGG  PLACE Motif 
REGTAAGCCCATTGGGCTGA-1831203218312048-389-405
 OsREG655TAAGCCCA          PPDB MotifGCCCA  PLACE Motif 
 OsREG429 AAGCCCAT         PPDB MotifGCCCA  PLACE Motif 
 OsREG432  AGCCCATT        PPDB MotifGCCCA  PLACE Motif 
 OsREG460       ATTGGGCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG511        TTGGGCTG  PPDB MotifGCCCA  PLACE Motif 
 OsREG657         TGGGCTGA PPDB MotifGCCCA  PLACE Motif 
REGGCCCAAAA-1831205618312063-413-420
 OsREG592GCCCAAAA PPDB MotifGCCCA  PLACE Motif 
REGTGAGGGAC-1831208418312091-441-448
 OsREG652TGAGGGAC PPDB MotifGGGACCC  PLACE Motif 
REGCGTCGGAT-1831213418312141-491-498
 OsREG483CGTCGGAT PPDB MotifCCGAC  PLACE MotifCGACG 
REGGTGGCCCACGTGGC-1831223718312250-594-607
 OsREG653GTGGCCCA       PPDB MotifGCCCA  PLACE Motif 
 OsREG654 TGGCCCAC      PPDB MotifGCCCA  PLACE Motif 
 OsREG571  GGCCCACG     PPDB MotifGCCCA  PLACE Motif 
 OsREG449   GCCCACGT    PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 
 OsREG508    CCCACGTG   PPDB MotifACGT  PLACE Motif 
 OsREG507      CACGTGGC PPDB MotifACGT  PLACE MotifACGTGKC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.