version
PlantPromoterDB promoter information of J080319G19

Summary of Gene (J080319G19)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0162500        NCBI 
Gene model J080319G19  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 3361624-3360425)

Genome position     
from initiation codon
009-128-F05         
009-181-F03         
AK058907            
AK121223            
J023090I10          
J023136J11          
J033029I19          
J033044N05          
J033084I05          
J053097J20          
J053098F01          
J065065B09          
J065082M04          
J065188O05          
J075057P15          
J075061J08          
J075061N15          
J075131I08          
J075133N07          
J075141H13          
J075168I19          
J080062E14          
J080062P15          
J080318G17          
J090001L10          
J090024I18          
J090029O21          
J090033F24          
J090036M16          
J090040I24          
J090048P06          
J090049B12          
J090068C02          
J090069O04          
J090078L09          
J090084H22          
J100022L03          
J100028O14          
J100028O18          
J100030M20          
J100032A15          
J100033D21          
J100034J23          
J100043K22          
J100052M22          
J100053N03          
J100074N24          
J100082J10          
TSS from cDNA
TSS information
J080319G19                       5'->3' (-)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J080319G19

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone-3360716-92
TSS clone peakGclone-3360708-84

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCATATATAAAG-33607423360752-118-128
Y PatchCCTTCCCT-33607173360724-93-100
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCCCATAT-33607483360755-124-131
 OsREG480GCCCATAT PPDB MotifGCCCA  PLACE Motif 
REGCCCCCGCG-33607633360770-139-146
 OsREG537CCCCCGCG PPDB Motif  PLACE Motif 
REGGGTCCCACTTG-33608143360824-190-200
 OsREG650GGTCCCAC    PPDB MotifGGGACCC  PLACE Motif 
 OsREG498   CCCACTTG PPDB MotifGCCCA  PLACE Motif 
REGTTGGCCCAGCCCATAA-33608323360847-208-223
 OsREG660TTGGCCCA         PPDB MotifGCCCA  PLACE Motif 
 OsREG578 TGGCCCAG        PPDB MotifGCCCA  PLACE Motif 
 OsREG620  GGCCCAGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG603   GCCCAGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG533    CCCAGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG523     CCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG491      CAGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG465       AGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG605        GCCCATAA PPDB MotifGCCCA  PLACE Motif 
REGCCTGGGCCGTC-33608673360877-243-253
 OsREG550CCTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG565 CTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG445  TGGGCCGT  PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG584   GGGCCGTC PPDB MotifGCCCA  PLACE Motif 
REGCATGGGCT-33608803360887-256-263
 OsREG467CATGGGCT PPDB MotifGCCCA, CCATGG  PLACE Motif 
REGTTGGCCCATCC-33608983360908-274-284
 OsREG660TTGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG488 TGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG590  GGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG608   GCCCATCC PPDB MotifGCCCA  PLACE Motif 
REGACCGGCCCAATT-33609223360933-298-309
 OsREG440ACCGGCCC     PPDB MotifGCCCA, AACCG(G/A)  PLACE Motif 
 OsREG542 CCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG563  CGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG492   GGCCCAAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG433    GCCCAATT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.