version
PlantPromoterDB promoter information of J090004P12

Summary of Gene (J090004P12)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0581800        NCBI 
Gene model J090004P12  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 22137336-22138535)

Genome position     
from initiation codon
009-177-G11         
AK059201            
AK121839            
J023022K06          
J023110K21          
J033100N18          
J033120D11          
J065044P15          
J065102G22          
J065149N14          
J065201L18          
J065205K10          
J075035D19          
J075073E06          
J075134M11          
J090070H20          
J090087B04          
J100028F10          
J100036M18          
J100065C24          
J100080O13          
TSS from cDNA
TSS information
J090004P12                       5'->3' (+)
Promoter sequence









 
                    
Os03g0581700        
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J090004P12

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+22138320-16

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGCCACGT+2213803122138038-305-298
 OsREG448CGCCACGT PPDB MotifACGT  PLACE MotifACGTGKC 
REGTGAGGGACCCG+2213809622138106-240-230
 OsREG652TGAGGGAC    PPDB MotifGGGACCC  PLACE Motif 
 OsREG569   GGGACCCG PPDB MotifGGGACCC  PLACE Motif 
REGTAAGCCCATCCGGCCCAAAT+2213819122138210-145-126
 OsREG655TAAGCCCA             PPDB MotifGCCCA  PLACE Motif 
 OsREG429 AAGCCCAT            PPDB MotifGCCCA  PLACE Motif 
 OsREG466  AGCCCATC           PPDB MotifGCCCA  PLACE Motif 
 OsREG608   GCCCATCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG644        TCCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG542         CCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG563          CGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG625           GGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG493            GCCCAAAT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.