version
PlantPromoterDB promoter information of J090007O03

Summary of Gene (J090007O03)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0809300        NCBI 
Gene model J090007O03  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 34695329-34694130)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
J090007O03                       5'->3' (-)
Promoter sequence

 
AK102250            
J033088G19          
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence


 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J090007O03

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-34700580-451

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAAGCCCATTT-3470062934700639-500-510
 OsREG421AAAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG429 AAGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG432  AGCCCATT  PPDB MotifGCCCA  PLACE Motif 
 OsREG422   GCCCATTT PPDB MotifGCCCA  PLACE Motif 
REGTATTGGGCCCAGAT-3470064934700662-520-533
 OsREG596TATTGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG492 ATTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG639  TTGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG579    GGGCCCAG   PPDB MotifGCCCA  PLACE Motif 
 OsREG629     GGCCCAGA  PPDB MotifGCCCA  PLACE Motif 
 OsREG486      GCCCAGAT PPDB MotifGCCCA  PLACE Motif 
REGTATTGGGCTTA-3470068434700694-555-565
 OsREG596TATTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG460 ATTGGGCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG426  TTGGGCTT  PPDB MotifGCCCA  PLACE Motif 
 OsREG655   TGGGCTTA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakGclone+34694956AK102250, J033088G19, AK102250

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGACAGGTGG+3469468834694696AK102250, J033088G19
 OsREG501GACAGGTG  PPDB Motif  PLACE Motif 
 OsREG436 ACAGGTGG PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.