PlantPromoterDB promoter information of J090007P04
Summary of Gene (J090007P04)
|
Overview
|
Focused view (chromosome 6: 21778767-21777568)
|
Genome position
from initiation codon 011-025-C09 AK066548 D13758 J013069H14 J053037J07 J065011J03 J065078L15 J065103H24 J065157A07 J065213P12 J090052N23 TSS from cDNA TSS information J090007P04 5'->3' (-) Promoter sequence TSS from cDNA TSS information 3'->5' (+) Promoter sequence |
|
|
|
Promoter Summary of J090007P04
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS clone peak | A | clone | - | 21778656 | -89 |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | CTCTCTCC | - | 21778631 | 21778638 | -64 | -71 |
| Y Patch | TCCCCCTC | - | 21778640 | 21778647 | -73 | -80 |
| Y Patch | TCCCCCTCTCCTCC | - | 21778663 | 21778676 | -96 | -109 |
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | CACGCCAC | - | 21778713 | 21778720 | -146 | -153 | |||
| OsREG502 | CACGCCAC | PPDB Motif | PLACE Motif | ||||||
| REG | ATCCCCCA | - | 21778739 | 21778746 | -172 | -179 | |||
| OsREG482 | ATCCCCCA | PPDB Motif | PLACE Motif | ||||||
| REG | CCCACCCGGCCCGGCCCACA | - | 21778764 | 21778783 | -197 | -216 | |||
| OsREG528 | CCCACCCG | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG538 | CCCGGCCCGGCCC | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG544 | CGGCCCGG | PPDB Motif | PLACE Motif | ||||||
| OsREG616 | GGCCCGGC | PPDB Motif | PLACE Motif | ||||||
| OsREG614 | GCCCGGCC | PPDB Motif | PLACE Motif | ||||||
| OsREG542 | CCGGCCCA | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG564 | CGGCCCAC | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG627 | GGCCCACA | PPDB Motif | GCCCA | PLACE Motif | |||||
| REG | ACAGGTGGGACC | - | 21778920 | 21778931 | -353 | -364 | |||
| OsREG436 | ACAGGTGG | PPDB Motif | PLACE Motif | ||||||
| OsREG514 | CAGGTGGG | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG651 | GGTGGGAC | PPDB Motif | GGGACCC | PLACE Motif | |||||
| OsREG650 | GTGGGACC | PPDB Motif | GGGACCC | PLACE Motif | |||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | None | None | None | ||||||