version
PlantPromoterDB promoter information of J090008N20

Summary of Gene (J090008N20)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0816800        NCBI 
Gene model J090008N20  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 35899052-35900251)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
J090008N20                       5'->3' (+)
Promoter sequence



 
009-132-E07         
AK059572            
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J090008N20

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+35900439-63

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTTCCTC+3590044535900452-57-50
Y PatchCCTTCCTCC+3590046135900469-41-33
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCCACGCC+3590014835900155-354-347
 OsREG636TCCACGCC PPDB Motif  PLACE Motif 
REGGGACGCGTCCACCAAC+3590024335900258-259-244
 OsREG442GGACGCGTCC       PPDB Motif  PLACE Motif 
 OsREG520        CCACCAAC PPDB MotifCCAACGG  PLACE Motif 
REGAAATGGGCCTACGGCCCATTA+3590029035900310-212-192
 OsREG422AAATGGGC              PPDB MotifGCCCA  PLACE Motif 
 OsREG431 AATGGGCC   GGCCCATT  PPDB MotifGCCCA  PLACE Motif 
 OsREG474  ATGGGCCT            PPDB MotifGCCCA  PLACE Motif 
 OsREG656   TGGGCCTA           PPDB MotifGCCCA  PLACE Motif 
 OsREG645         TACGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG445          ACGGCCCA    PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG490           CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG610             GCCCATTA PPDB MotifGCCCA  PLACE Motif 
REGAGCCCATAA+3590031435900322-188-180
 OsREG465AGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG605 GCCCATAA PPDB MotifGCCCA  PLACE Motif 
REGTAGGCCCATTA+3590032735900337-175-165
 OsREG656TAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG474 AGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG431  GGCCCATT  PPDB MotifGCCCA  PLACE Motif 
 OsREG610   GCCCATTA PPDB MotifGCCCA  PLACE Motif 
REGAGCCCATAA+3590034135900349-161-153
 OsREG465AGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG605 GCCCATAA PPDB MotifGCCCA  PLACE Motif 
REGAATTGGGCCCAACT+3590035235900365-150-137
 OsREG433AATTGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG492 ATTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG639  TTGGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG626     GGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG479      GCCCAACT PPDB MotifGCCCA  PLACE Motif 
REGAATTGGGCCTC+3590037735900387-125-115
 OsREG433AATTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG492 ATTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG471  TTGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG587   TGGGCCTC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakGclone-35900246AK059572, AK059572, 009-132-E07

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTCCTC-3590022835900235009-132-E07, AK059572
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.