version
PlantPromoterDB promoter information of J090008P21

Summary of Gene (J090008P21)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0568300        NCBI 
Gene model J090008P21  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 23500670-23501869)

Genome position     
from initiation codon
AK067784            
AK067895            
J013119M01          
J013120B09          
J013123G12          
J023012C12          
J023020G17          
J023037E23          
J033076I01          
J033108A07          
J033138J02          
J075033L09          
J075049E02          
J075060N23          
J075094H13          
J075179L18          
J080005P09          
J080044J03          
J080062G20          
J080063L23          
J080065B16          
J080071K09          
J080089C23          
J090046B22          
J090094C19          
J090096B19          
J100060G03          
J100082D16          
TSS from cDNA
TSS information
J090008P21                       5'->3' (+)
Promoter sequence











 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J090008P21

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+23501144-526

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCTCCTCCTCTT+2350114923501161-521-509
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGCGACGCG+2350086023500868-810-802
 OsREG556CGCGACGC  PPDB Motif  PLACE MotifCGACG 
 OsREG559 GCGACGCG PPDB Motif  PLACE MotifCGACG 
REGTCGTGGGCCCCACCCGCGC+2350091023500928-760-742
 OsREG601TCGTGGGC            PPDB MotifGCCCA  PLACE Motif 
 OsREG571 CGTGGGCC           PPDB MotifGCCCA  PLACE Motif 
 OsREG640  GTGGGCCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG647   TGGGCCCC         PPDB MotifGCCCA  PLACE Motif 
 OsREG641    GGGCCCCA        PPDB MotifGCCCA  PLACE Motif 
 OsREG631     GGCCCCAC       PPDB Motif  PLACE Motif 
 OsREG612      GCCCCACC      PPDB Motif  PLACE Motif 
 OsREG528        CCCACCCG    PPDB MotifGCCCA  PLACE Motif 
 OsREG439           ACCCGCGC PPDB Motif  PLACE Motif 
REGCCACTGACAGGTGGGTCCCAC+2350099623501016-674-654
 OsREG522CCACTGAC              PPDB Motif  PLACE MotifTGAC 
 OsREG510 CACTGACA             PPDB Motif  PLACE MotifTGAC 
 OsREG453  ACTGACAG            PPDB Motif  PLACE MotifTGAC 
 OsREG551   CTGACAGG           PPDB Motif  PLACE MotifTGAC 
 OsREG501     GACAGGTG         PPDB Motif  PLACE Motif 
 OsREG436      ACAGGTGG        PPDB Motif  PLACE Motif 
 OsREG514       CAGGTGGG       PPDB MotifGCCCA  PLACE Motif 
 OsREG622          GTGGGTCC    PPDB MotifGGGACCC  PLACE Motif 
 OsREG637           TGGGTCCC   PPDB MotifGGGACCC  PLACE Motif 
 OsREG648            GGGTCCCA  PPDB MotifGGGACCC  PLACE Motif 
 OsREG650             GGTCCCAC PPDB MotifGGGACCC  PLACE Motif 
REGCCCGGGCCC+2350102423501032-646-638
 OsREG539CCCGGGCC  PPDB Motif  PLACE Motif 
 OsREG543 CCGGGCCC PPDB MotifGCCCA  PLACE Motif 
REGGCGGGTCG+2350105723501064-613-606
 OsREG552GCGGGTCG PPDB Motif  PLACE Motif 
REGTGGGGGATG+2350107323501081-597-589
 OsREG482TGGGGGAT  PPDB Motif  PLACE Motif 
 OsREG516 GGGGGATG PPDB Motif  PLACE Motif 
REGGACGTGGCG+2350108723501095-583-575
 OsREG585GACGTGGC  PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG448 ACGTGGCG PPDB MotifACGT  PLACE MotifACGTGKC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.