version
PlantPromoterDB promoter information of J090009B09

Summary of Gene (J090009B09)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0924000        NCBI 
Gene model J090009B09  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 42247759-42248958)

Genome position     
from initiation codon
004-020-C09         
005-014-A06         
009-085-G12         
009-123-A08         
009-134-A05         
009-137-F06         
016-016-B08         
AF050674            
AK061690            
AK120797            
J013040A15          
J013104L20          
J013127E12          
J013158O05          
J023012E09          
J023126L23          
J023143B03          
J065005B16          
J065101J15          
J065105K16          
J065155K16          
J065171M17          
J065182F07          
J065187D10          
J065194I24          
J065207E24          
J075001C24          
J075090O10          
J075095H17          
J075109M24          
J075123C18          
J075148G22          
J090075K17          
J090081H23          
J090097H21          
J100063P14          
TSS from cDNA
TSS information
J090009B09                       5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J090009B09

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+42248710-49

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCCTCTCC+4224866142248669-98-90
Y PatchTCTCTTTC+4224871442248721-45-38
Y PatchTTCTCCTC+4224872442248731-35-28
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTATGGGCCGGCCC+4224843642248449-323-310
 OsREG606GTATGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG630 TATGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG490  ATGGGCCG     PPDB MotifGCCCA  PLACE Motif 
 OsREG542   TGGGCCGG    PPDB MotifGCCCA  PLACE Motif 
 OsREG615    GGGCCGGCCC PPDB MotifGCCCA  PLACE Motif 
REGGAAGCCCACAA+4224846842248478-291-281
 OsREG582GAAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG427 AAGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG461  AGCCCACA  PPDB MotifGCCCA  PLACE Motif 
 OsREG597   GCCCACAA PPDB MotifGCCCA  PLACE Motif 
REGCGGGCCCACAA+4224848242248492-277-267
 OsREG566CGGGCCCA    PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG640 GGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG627  GGCCCACA  PPDB MotifGCCCA  PLACE Motif 
 OsREG597   GCCCACAA PPDB MotifGCCCA  PLACE Motif 
REGCCCACGTGCTGGGCCGGC+4224852542248542-234-217
 OsREG508CCCACGTG           PPDB MotifACGT  PLACE Motif 
 OsREG620       GCTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG565        CTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG542         TGGGCCGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG615          GGGCCGGC PPDB MotifGCCCA  PLACE Motif 
REGGCTGGGCCAA+4224856842248577-191-182
 OsREG620GCTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG578 CTGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG660  TGGGCCAA PPDB MotifGCCCA  PLACE Motif 
REGACGTGGGCCGGA+4224858142248592-178-167
 OsREG449ACGTGGGC     PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 
 OsREG571 CGTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG564  GTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG542   TGGGCCGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG644    GGGCCGGA PPDB MotifGCCCA  PLACE Motif 
REGTGATGGGCCGTA+4224861142248622-148-137
 OsREG607TGATGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG590 GATGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG490  ATGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG445   TGGGCCGT  PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG645    GGGCCGTA PPDB MotifGCCCA  PLACE Motif 
REGAGCCCACGT+4224865142248659-108-100
 OsREG463AGCCCACG  PPDB MotifGCCCA  PLACE Motif 
 OsREG449 GCCCACGT PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.