version
PlantPromoterDB promoter information of J090012D16

Summary of Gene (J090012D16)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0760600        NCBI 
Gene model J090012D16  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 33760253-33759054)

Genome position     
from initiation codon
011-038-B09         
AB110193            
AK067557            
AK099338            
AK103133            
AK103586            
AK104829            
D14673              
J013045H08          
J013112H20          
J013160H01          
J023030P20          
J023050D22          
J023068A22          
J023110C16          
J033023A15          
J033025N16          
J033026K01          
J033026M02          
J033028M22          
J033036D08          
J033038A21          
J033039M10          
J033039P15          
J033044D24          
J033051F18          
J033066A18          
J033073G10          
J033075B15          
J033079I16          
J033087C12          
J033095C16          
J033096E09          
J033096J07          
J033101B17          
J033108F14          
J033122E12          
J033124G02          
J033129K21          
J033130O03          
J033133B14          
J033141B06          
J033141O12          
J090003F07          
J090009P10          
J090023K01          
J090030J17          
J090033G02          
J090037I22          
J090037P05          
J090048K09          
J090059P09          
J090060E03          
J090069N01          
J090078C19          
J090079K07          
J090086I19          
J090089P15          
J090093D07          
J090095H01          
J100047J15          
J100057J03          
TSS from cDNA
TSS information
J090012D16                       5'->3' (-)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J090012D16

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-33759536-283

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTGCCTATATAAAAA-3375956333759576-310-323
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGGATCGG-3375958433759591-331-338
 OsREG541CGGATCGG PPDB Motif  PLACE Motif 
REGGCTTTCCC-3375959533759602-342-349
 OsREG621GCTTTCCC PPDB Motif  PLACE Motif 
REGGAGGCGTGGA-3375962633759635-373-382
 OsREG503GAGGCGTG   PPDB Motif  PLACE Motif 
 OsREG636  GGCGTGGA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakAclone-33759167J090078C19, J090003F07, J090093D07, AK103133, J023110C16, J033028M22, J033044D24, J090033G02, J033095C16, AK104829, J090023K01, J090048K09, J100057J03, J090089P15, D14673, AB110193, 011-038-B09, J090095H01, J090038A17, J090009P10, J090037I22, J090069N01, J033038A21

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCCTCCTCC-3375913433759144011-038-B09, AB110193, AK103133, AK104829, D14673, J023110C16, J033028M22, J033038A21, J033044D24, J033095C16, J090003F07, J090009P10, J090023K01, J090033G02, J090037I22, J090038A17, J090048K09, J090069N01, J090078C19, J090089P15, J090093D07, J090095H01, J100057J03
Y PatchCCTTCCTCC-3375917033759178011-038-B09, AB110193, AK103133, AK104829, D14673, J023110C16, J033028M22, J033038A21, J033044D24, J033095C16, J090003F07, J090009P10, J090023K01, J090033G02, J090037I22, J090038A17, J090048K09, J090069N01, J090078C19, J090089P15, J090093D07, J090095H01, J100057J03
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCTTGGGCCAC-3375925533759264011-038-B09, AB110193, AK103133, AK104829, D14673, J023110C16, J033028M22, J033038A21, J033044D24, J033095C16, J090003F07, J090009P10, J090023K01, J090033G02, J090037I22, J090038A17, J090048K09, J090069N01, J090078C19, J090089P15, J090093D07, J090095H01, J100057J03
 OsREG581CTTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG659 TTGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG653  TGGGCCAC PPDB MotifGCCCA  PLACE Motif 
REGCCCCCGCG-3375931533759322011-038-B09, AB110193, AK103133, AK104829, D14673, J023110C16, J033028M22, J033038A21, J033044D24, J033095C16, J090003F07, J090009P10, J090023K01, J090033G02, J090037I22, J090038A17, J090048K09, J090069N01, J090078C19, J090089P15, J090093D07, J090095H01, J100057J03
 OsREG537CCCCCGCG PPDB Motif  PLACE Motif 
REGCCCCCACGCCAC-3375934033759351011-038-B09, AB110193, AK103133, AK104829, D14673, J023110C16, J033028M22, J033038A21, J033044D24, J033095C16, J090003F07, J090009P10, J090023K01, J090033G02, J090037I22, J090038A17, J090048K09, J090069N01, J090078C19, J090089P15, J090093D07, J090095H01, J100057J03
 OsREG536CCCCCACG     PPDB Motif  PLACE Motif 
 OsREG502    CACGCCAC PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.