version
PlantPromoterDB promoter information of J090012D18

Summary of Gene (J090012D18)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0749900        NCBI 
Gene model J090012D18  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 33149957-33151156)

Genome position     
from initiation codon
AK103588            
J033090O22          
J033133C05          
J065122N01          
J065188K04          
J100074N02          
TSS from cDNA
TSS information
J090012D18                       5'->3' (+)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J090012D18

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakTclone+33150759-198

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGGATGGGCCGGT+3315051533150527-442-430
 OsREG534TGGATGGG      PPDB MotifGCCCA  PLACE Motif 
 OsREG608 GGATGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG590  GATGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG490   ATGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG542    TGGGCCGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG440     GGGCCGGT PPDB MotifGCCCA, AACCG(G/A)  PLACE Motif 
REGGCTGGGCCGC+3315054933150558-408-399
 OsREG620GCTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG565 CTGGGCCG  PPDB MotifGCCCA  PLACE Motif 
 OsREG618  TGGGCCGC PPDB MotifGCCCA  PLACE Motif 
REGAAAAGCCC+3315065333150660-304-297
 OsREG419AAAAGCCC PPDB MotifGCCCA  PLACE Motif 
REGAAAAGCCC+3315068033150687-277-270
 OsREG419AAAAGCCC PPDB MotifGCCCA  PLACE Motif 
REGCCTCGCCC+3315070433150711-253-246
 OsREG549CCTCGCCC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.