version
PlantPromoterDB promoter information of J090023D20

Summary of Gene (J090023D20)

Organism Oryza sativa  
Chromosome 12  
Locus Os12g0620400        NCBI 
Gene model J090023D20  
Description NONE  
#
#

Overview

Focused view (chromosome 12: 26657393-26656194)

Genome position     
from initiation codon
006-112-D10         
015-008-B10         
AK059006            
AK059973            
AK063843            
AK072503            
AK072934            
J013036F24          
J023126H05          
J023131G11          
J023146E17          
J033064P08          
J033095L07          
J065002A04          
J065101N06          
J065186F11          
J065215J15          
J080049H05          
J080059J06          
J080059L05          
J080061M17          
J080063D16          
J090012D01          
J090040A09          
J090044K08          
J090089L17          
J100019H03          
J100054N04          
TSS from cDNA
TSS information
J090023D20                       5'->3' (-)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J090023D20

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-26656530-137

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTATAAAAA-2665655226656559-159-166
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGGGGGAGGGCCGGG-2665663026656644-237-251
 OsREG574TGGGGGAG        PPDB Motif  PLACE Motif 
 OsREG538       GGGCCGGG PPDB MotifGCCCA  PLACE Motif 
REGGGTGGGACC-2665665526656663-262-270
 OsREG651GGTGGGAC  PPDB MotifGGGACCC  PLACE Motif 
 OsREG650 GTGGGACC PPDB MotifGGGACCC  PLACE Motif 
REGCACGTGGGGCCCGC-2665667926656692-286-299
 OsREG508CACGTGGG       PPDB MotifACGT  PLACE Motif 
 OsREG450 ACGTGGGG      PPDB MotifACGT  PLACE Motif 
 OsREG572  CGTGGGGC     PPDB Motif  PLACE Motif 
 OsREG631   GTGGGGCC    PPDB Motif  PLACE Motif 
 OsREG641    TGGGGCCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG567     GGGGCCCG  PPDB MotifACGGGC  PLACE Motif 
 OsREG619      GGGCCCGC PPDB MotifGCCCA  PLACE Motif 
REGCCCACCCG-2665670526656712-312-319
 OsREG528CCCACCCG PPDB MotifGCCCA  PLACE Motif 
REGGGCCGTCC-2665675526656762-362-369
 OsREG624GGCCGTCC PPDB Motif  PLACE Motif 
REGCTCCCCCACG-2665676526656774-372-381
 OsREG574CTCCCCCA   PPDB Motif  PLACE Motif 
 OsREG536  CCCCCACG PPDB Motif  PLACE Motif 
REGGTGGGTCC-2665682026656827-427-434
 OsREG622GTGGGTCC PPDB MotifGGGACCC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.