version
PlantPromoterDB promoter information of J090024K15

Summary of Gene (J090024K15)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0166800        NCBI 
Gene model J090024K15  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 3626881-3625682)

Genome position     
from initiation codon
006-038-C11         
012-080-F02         
AK070524            
AK121382            
J023022D19          
J023055G02          
J023073E02          
J023125B08          
J023127H21          
J033052G01          
J033067F13          
J065046L14          
J065178D11          
J065205N17          
J075006K17          
J075051D20          
J075109L04          
J090025N04          
J090049N09          
J090070N12          
J090078O21          
J090083L07          
J100063K16          
J100083D14          
TSS from cDNA
TSS information
J090024K15                       5'->3' (-)
Promoter sequence













 
                    
Os07g0166900        
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J090024K15

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-3626035-154

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCGTGGGCT-36260993626107-218-226
 OsREG601TCGTGGGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG463 CGTGGGCT PPDB MotifGCCCA  PLACE Motif 
REGTGCGGGCCCACCCACGGG-36261103626127-229-246
 OsREG632TGCGGGCC           PPDB Motif  PLACE Motif 
 OsREG619 GCGGGCCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG566  CGGGCCCA         PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG640   GGGCCCAC        PPDB MotifGCCCA  PLACE Motif 
 OsREG628    GGCCCACC       PPDB MotifGCCCA  PLACE Motif 
 OsREG600     GCCCACCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG531          CCCACGGG PPDB MotifGCCCA, ACGGGC  PLACE Motif 
REGCAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTC-36261703626204-289-323
 OsREG514CAGGTGGG                            PPDB MotifGCCCA  PLACE Motif 
 OsREG622   GTGGGTCC                         PPDB MotifGGGACCC  PLACE Motif 
 OsREG637    TGGGTCCC                        PPDB MotifGGGACCC  PLACE Motif 
 OsREG648     GGGTCCCA                       PPDB MotifGGGACCC  PLACE Motif 
 OsREG516           CATCCCCC                 PPDB Motif  PLACE Motif 
 OsREG531                CCCGTGGG            PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG547                 CCGTGGGC           PPDB MotifGCCCA  PLACE Motif 
 OsREG571                  CGTGGGCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG640                   GTGGGCCC         PPDB MotifGCCCA  PLACE Motif 
 OsREG647                    TGGGCCCC        PPDB MotifGCCCA  PLACE Motif 
 OsREG641                     GGGCCCCA       PPDB MotifGCCCA  PLACE Motif 
 OsREG631                      GGCCCCAC      PPDB Motif  PLACE Motif 
 OsREG572                       GCCCCACG     PPDB Motif  PLACE Motif 
 OsREG450                        CCCCACGT    PPDB MotifACGT  PLACE Motif 
 OsREG508                         CCCACGTG   PPDB MotifACGT  PLACE Motif 
 OsREG434                          CCACGTGT  PPDB MotifACGT  PLACE Motif 
 OsREG509                           CACGTGTC PPDB MotifACGT  PLACE MotifACGTGKC 
REGGTCGCGTC-36262073626214-326-333
 OsREG583GTCGCGTC PPDB Motif  PLACE Motif 
REGTGTCAGTG-36262773626284-396-403
 OsREG510TGTCAGTG PPDB Motif  PLACE MotifTGAC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.