version
PlantPromoterDB promoter information of J090030C05

Summary of Gene (J090030C05)

Organism Oryza sativa  
Chromosome 8  
Locus Os08g0130500        NCBI 
Gene model J090030C05  
Description NONE  
#
#

Overview

Focused view (chromosome 8: 1723012-1721813)

Genome position     
from initiation codon
006-024-B12         
006-032-F11         
006-047-B12         
006-058-H06         
006-062-D07         
006-083-F11         
006-084-A11         
006-096-F12         
006-105-A04         
006-110-D11         
011-022-D11         
AK064857            
AK100956            
D21130              
J013000H12          
J013024M17          
J013028H09          
J013036D06          
J013039D01          
J013045N22          
J013049M20          
J013092K19          
J013106L12          
J013107A03          
J013109E12          
J013112B20          
J013114N08          
J013120J12          
J013121E21          
J013135P20          
J013153L14          
J023006J08          
J023013N01          
J023014L16          
J023020N03          
J023025K17          
J023027M24          
J023028I05          
J023029D18          
J023030A14          
J023041G23          
J023049H05          
J023056H02          
J023060I23          
J023078L07          
J023083L20          
J023099D07          
J023104A20          
J023105F18          
J023105M17          
J023112D21          
J023122M18          
J023126C03          
J023139J20          
J023140F10          
J023149L20          
J023150G04          
J033031G22          
J033036G02          
J033040M20          
J033042F16          
J033045P13          
J033046A22          
J033073P06          
J033086H16          
J033087D07          
J033089M14          
J033090J06          
J033095F14          
J033108M01          
J033115L03          
J033117A17          
J033121E17          
J033121N23          
J033122F03          
J033126A04          
J033144D13          
J033145D13          
J043017E06          
J043022M09          
J053025I11          
J053027K06          
J053029D15          
J053048I22          
J053055I01          
J053079P07          
J053090J23          
J053094C24          
J065023F18          
J065029I12          
J065044B18          
J065045C07          
J065063K22          
J065093D11          
J065096P09          
J065097E02          
J065099N04          
J065103K24          
J065110H12          
J065132F24          
J065157K16          
J065185D11          
J065202E16          
J065217D07          
J075053I19          
J075055L24          
J075056H24          
J075070D02          
J075084O15          
J075090F24          
J075135E03          
J075174A01          
J075188F05          
J075192C17          
J080001B02          
J080001C08          
J080002D15          
J080002I03          
J080003E24          
J080004M10          
J080005C18          
J080006A12          
J080006F04          
J080006M11          
J080008J11          
J080008J22          
J080009F14          
J080010B12          
J080010G14          
J080010N07          
J080011D04          
J080011G10          
J080011O19          
J080013K23          
J080013M09          
J080013N12          
J080013O15          
J080014C13          
J080014D21          
J080014F08          
J080014N08          
J080014P19          
J080015L09          
J080015P15          
J080018P10          
J080020C06          
J080022C14          
J080022E01          
J080022P04          
J080022P10          
J080023B20          
J080023G19          
J080024N15          
J080025E11          
J080025G24          
J080026B01          
J080026B05          
J080027L17          
J080028K02          
J080029L23          
J080030D08          
J080031C03          
J080031K02          
J080032C16          
J080033F10          
J080033G12          
J080033K03          
J080034B03          
J080034N21          
J080034O03          
J080035G10          
J080038E14          
J080039A19          
J080039G10          
J080039J01          
J080039J09          
J080040F07          
J080040H18          
J080041E08          
J080041E16          
J080041L08          
J080042A07          
J080044E02          
J080045K03          
J080046O03          
J080047F08          
J080048H01          
J080048I05          
J080048N06          
J080050A07          
J080050B04          
J080050E21          
J080051J01          
J080051K02          
J080051L02          
J080052C20          
J080052I22          
J080052J21          
J080052K22          
J080055A05          
J080055I12          
J080056A21          
J080056N11          
J080057D02          
J080058H21          
J080058P16          
J080059M03          
J080059N17          
J080060F13          
J080060H06          
J080060J03          
J080060O09          
J080060P22          
J080061F06          
J080061H21          
J080061O13          
J080062J07          
J080063A08          
J080063F19          
J080063O18          
J080065D15          
J080066E13          
J080068L01          
J080068P07          
J080069I21          
J080070M04          
J080071E01          
J080071J08          
J080071M23          
J080072A03          
J080072G18          
J080075A04          
J080075E19          
J080075P18          
J080076N11          
J080077A11          
J080077D22          
J080077H18          
J080077L03          
J080078D02          
J080078L05          
J080078N20          
J080079I20          
J080081D04          
J080082A07          
J080082E24          
J080084A22          
J080084E15          
J080084G06          
J080086A05          
J080086F09          
J080087B11          
J080087H12          
J080088I05          
J080088N08          
J080088P07          
J080089A09          
J080089D21          
J080089F24          
J080089H22          
J080089I04          
J080090D01          
J080091F09          
J080091G18          
J080091L24          
J080091M12          
J080091N12          
J080093A15          
J080093C08          
J080093I08          
J080093P21          
J080094E18          
J080094F15          
J080094J21          
J080095A09          
J080096G05          
J080096K07          
J080097M17          
J080097P21          
J080302B15          
J080306J15          
J080306O13          
J080307C15          
J080307I04          
J080307L05          
J080308F11          
J080311C04          
J080311I07          
J080312C01          
J080312O08          
J080315F14          
J080318K13          
J080319A17          
J090001I01          
J090002O18          
J090004D11          
J090004K19          
J090007A08          
J090007F22          
J090008D09          
J090008L07          
J090008O08          
J090012N11          
J090013M05          
J090015E21          
J090020E08          
J090020O20          
J090021I10          
J090023D07          
J090023K22          
J090023O08          
J090028D21          
J090029H14          
J090029L12          
J090031D18          
J090032G10          
J090034J22          
J090034K16          
J090036D10          
J090037N17          
J090038B03          
J090039E04          
J090043P17          
J090044L20          
J090045N16          
J090048K03          
J090048K10          
J090049O07          
J090055H23          
J090056G12          
J090056G16          
J090059B16          
J090066H21          
J090067D22          
J090072M07          
J090073J21          
J090075A15          
J090079J09          
J090080L07          
J090084A03          
J090085B07          
J090085C18          
J090085L11          
J090087G21          
J090088H11          
J090090J12          
J090091I21          
J090091L02          
J090093G18          
J090094D23          
J090094P17          
J090095G12          
J090095I04          
J090098L19          
J100017I22          
J100017M16          
J100018F08          
J100018G19          
J100019B05          
J100019J18          
J100019L04          
J100023M06          
J100024J23          
J100024P09          
J100027I05          
J100029G03          
J100029K08          
J100031J17          
J100037L16          
J100038C05          
J100039D19          
J100041L02          
J100045B08          
J100045B15          
J100047G07          
J100047P19          
J100048I15          
J100049M16          
J100049P18          
J100050E21          
J100051N02          
J100052M02          
J100055M24          
J100056K11          
J100059F20          
J100059J15          
J100068C19          
J100068G06          
J100069N02          
J100073N04          
J100074B05          
J100080P13          
J100081J15          
J100083P09          
J100084B11          
J100085B07          
J100086O20          
J100087B02          
J100089B14          
TSS from cDNA
TSS information
J090030C05                       5'->3' (-)
Promoter sequence











 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J090030C05

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-1722140-128

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCCACTATAAATA-17221671722178-155-166
Y PatchCTCCTCCTC-17220931722101-81-89
Y PatchTCCCTCTC-17221791722186-167-174
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCAAGCCCATCAGGCCCACCAAC-17222021722224-190-212
 OsREG519CCAAGCCC                PPDB MotifGCCCA  PLACE Motif 
 OsREG496 CAAGCCCA               PPDB MotifGCCCA  PLACE Motif 
 OsREG429  AAGCCCAT              PPDB MotifGCCCA  PLACE Motif 
 OsREG466   AGCCCATC             PPDB MotifGCCCA  PLACE Motif 
 OsREG607    GCCCATCA            PPDB MotifGCCCA  PLACE Motif 
 OsREG646         TCAGGCCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG513          CAGGCCCA      PPDB MotifGCCCA  PLACE Motif 
 OsREG472           AGGCCCAC     PPDB MotifGCCCA  PLACE Motif 
 OsREG628            GGCCCACC    PPDB MotifGCCCA  PLACE Motif 
 OsREG599             GCCCACCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG520               CCACCAAC PPDB MotifCCAACGG  PLACE Motif 
REGAGCCCAATAAGGCCCATCT-17222571722275-245-263
 OsREG460AGCCCAAT            PPDB MotifGCCCA  PLACE Motif 
 OsREG596 GCCCAATA           PPDB MotifGCCCA  PLACE Motif 
 OsREG430        AAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG474         AGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG590          GGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG456           GCCCATCT PPDB MotifGCCCA  PLACE Motif 
REGCAAGGCCCATAC-17222831722294-271-282
 OsREG497CAAGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG430 AAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG474  AGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG630   GGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG606    GCCCATAC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.