version
PlantPromoterDB promoter information of J090036G23

Summary of Gene (J090036G23)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0607800        NCBI 
Gene model J090036G23  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 25644710-25645909)

Genome position     
from initiation codon
012-042-C02         
015-097-B06         
AK069010            
AK071711            
J013170I18          
J023112M23          
TSS from cDNA
TSS information
J090036G23                       5'->3' (+)
Promoter sequence


 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J090036G23

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+25644787-923

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCAGCCCACCACGCCTCCACGCC+2564456025644582-1150-1128
 OsREG523CCAGCCCA                PPDB MotifGCCCA  PLACE Motif 
 OsREG462  AGCCCACC              PPDB MotifGCCCA  PLACE Motif 
 OsREG599   GCCCACCA             PPDB MotifGCCCA  PLACE Motif 
 OsREG527    CCCACCAC            PPDB MotifGCCCA  PLACE Motif 
 OsREG503         CACGCCTC       PPDB Motif  PLACE Motif 
 OsREG636               TCCACGCC PPDB Motif  PLACE Motif 
REGCACGCCTC+2564461225644619-1098-1091
 OsREG503CACGCCTC PPDB Motif  PLACE Motif 
REGCGCCACGTC+2564462825644636-1082-1074
 OsREG448CGCCACGT  PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG585 GCCACGTC PPDB MotifACGT  PLACE MotifACGTGKC 
REGCCGATCCG+2564465225644659-1058-1051
 OsREG541CCGATCCG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakGclone+25645866009-036-C11

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGGCCGTTGG+2564562525645633009-036-C11
 OsREG494GGCCGTTG  PPDB MotifCCAACGG  PLACE Motif 
 OsREG518 GCCGTTGG PPDB MotifCCAACGG  PLACE Motif 
REGTGGGGGAG+2564570225645709009-036-C11
 OsREG574TGGGGGAG PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.