version
PlantPromoterDB promoter information of J090036H16

Summary of Gene (J090036H16)

Organism Oryza sativa  
Chromosome 11  
Locus Os11g0549690        NCBI 
Gene model J090036H16  
Description NONE  
#
#

Overview

Focused view (chromosome 11: 22262605-22261406)

Genome position     
from initiation codon
J065085G07          
J065218B08          
J090052L05          
TSS from cDNA
TSS information
J090036H16                       5'->3' (-)
Promoter sequence











 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J090036H16

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-22261742-137

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATTTGGGCCCACCTGT-2226180222261817-197-212
 OsREG493ATTTGGGC         PPDB MotifGCCCA  PLACE Motif 
 OsREG625 TTTGGGCC        PPDB MotifGCCCA  PLACE Motif 
 OsREG639  TTGGGCCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG640    GGGCCCAC     PPDB MotifGCCCA  PLACE Motif 
 OsREG628     GGCCCACC    PPDB MotifGCCCA  PLACE Motif 
 OsREG476      GCCCACCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG514       CCCACCTG  PPDB MotifGCCCA  PLACE Motif 
 OsREG436        CCACCTGT PPDB Motif  PLACE Motif 
REGCCAGCCCAACA-2226182022261830-215-225
 OsREG523CCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG511 CAGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG458  AGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG594   GCCCAACA PPDB MotifGCCCA  PLACE Motif 
REGCCAGCCCAACA-2226186522261875-260-270
 OsREG523CCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG511 CAGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG458  AGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG594   GCCCAACA PPDB MotifGCCCA  PLACE Motif 
REGATATGGGCCCT-2226189722261907-292-302
 OsREG480ATATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG630 TATGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG489  ATGGGCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG475   TGGGCCCT PPDB MotifGCCCA  PLACE Motif 
REGAGTGGGCCGGGCCCAACT-2226191022261927-305-322
 OsREG478AGTGGGCC           PPDB MotifGCCCA  PLACE Motif 
 OsREG564 GTGGGCCG          PPDB MotifGCCCA  PLACE Motif 
 OsREG542  TGGGCCGG         PPDB MotifGCCCA  PLACE Motif 
 OsREG538   GGGCCGGG        PPDB MotifGCCCA  PLACE Motif 
 OsREG614    GGCCGGGC       PPDB Motif  PLACE Motif 
 OsREG616     GCCGGGCC      PPDB Motif  PLACE Motif 
 OsREG543      CCGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG566       CGGGCCCA    PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG639        GGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG626         GGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG479          GCCCAACT PPDB MotifGCCCA  PLACE Motif 
REGGCCCACAA-2226194922261956-344-351
 OsREG597GCCCACAA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.