version
PlantPromoterDB promoter information of J090045C11

Summary of Gene (J090045C11)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0101500        NCBI 
Gene model J090045C11  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 86481-87680)

Genome position     
from initiation codon
AK059667            
AK071749            
J023112L07          
J033046F08          
J065050F03          
J075020M17          
J090015C05          
TSS from cDNA
TSS information
J090045C11                       5'->3' (+)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J090045C11

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+87421-60

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCTCCTCTT+8737287381-109-100
Y PatchTCTTCCTC+8743987446-42-35
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCCGGCCCACGA+8720787218-274-263
 OsREG615GCCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG542 CCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG564  CGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG571   GGCCCACG  PPDB MotifGCCCA  PLACE Motif 
 OsREG601    GCCCACGA PPDB MotifGCCCA  PLACE Motif 
REGATCTGGGCCCCAC+8723287244-249-237
 OsREG486ATCTGGGC      PPDB MotifGCCCA  PLACE Motif 
 OsREG629 TCTGGGCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG579  CTGGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG647   TGGGCCCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG641    GGGCCCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG631     GGCCCCAC PPDB Motif  PLACE Motif 
REGCGGGCCGTCC+8733087339-151-142
 OsREG446CGGGCCGT   PPDB MotifACGGGC  PLACE Motif 
 OsREG584 GGGCCGTC  PPDB MotifGCCCA  PLACE Motif 
 OsREG624  GGCCGTCC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.