version
PlantPromoterDB promoter information of J090045O22

Summary of Gene (J090045O22)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0588200        NCBI 
Gene model J090045O22  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 24568388-24567189)

Genome position     
from initiation codon
006-052-E10         
AJ251563            
AK070745            
AK104055            
AK104419            
J023057A07          
J023068C08          
J023148E24          
J090045P03          
J090050C18          
J100023F01          
J100051I18          
J100060P17          
TSS from cDNA
TSS information
J090045O22                       5'->3' (-)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J090045O22

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-24567520-132
TSS clone peakGclone-24567466-78

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACCCGCGCCCACGCCCAGCC-2456760624567625-218-237
 OsREG439ACCCGCGC             PPDB Motif  PLACE Motif 
 OsREG602      GCCCACGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG603            GCCCAGCC PPDB MotifGCCCA  PLACE Motif 
REGGACGCGAC-2456765724567664-269-276
 OsREG583GACGCGAC PPDB Motif  PLACE Motif 
REGTGCGGGCCCCACTGACAG-2456770324567720-315-332
 OsREG632TGCGGGCC           PPDB Motif  PLACE Motif 
 OsREG619 GCGGGCCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG567  CGGGCCCC         PPDB MotifACGGGC  PLACE Motif 
 OsREG641   GGGCCCCA        PPDB MotifGCCCA  PLACE Motif 
 OsREG631    GGCCCCAC       PPDB Motif  PLACE Motif 
 OsREG522        CCACTGAC   PPDB Motif  PLACE MotifTGAC 
 OsREG510         CACTGACA  PPDB Motif  PLACE MotifTGAC 
 OsREG453          ACTGACAG PPDB Motif  PLACE MotifTGAC 
REGGCCCACCAC-2456773624567744-348-356
 OsREG599GCCCACCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG527 CCCACCAC PPDB MotifGCCCA  PLACE Motif 
REGCCAGGCCCAACCAAGCCCACGG-2456779624567817-408-429
 OsREG524CCAGGCCC               PPDB MotifGCCCA  PLACE Motif 
 OsREG513 CAGGCCCA              PPDB MotifGCCCA  PLACE Motif 
 OsREG471  AGGCCCAA             PPDB MotifGCCCA  PLACE Motif 
 OsREG626   GGCCCAAC            PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG595    GCCCAACC           PPDB MotifGCCCA  PLACE Motif 
 OsREG519          CCAAGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG496           CAAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG427            AAGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG463             AGCCCACG  PPDB MotifGCCCA  PLACE Motif 
 OsREG547              GCCCACGG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.