version
PlantPromoterDB promoter information of J090051N04

Summary of Gene (J090051N04)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0686800        NCBI 
Gene model J090051N04  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 30085743-30086942)

Genome position     
from initiation codon
006-098-B12         
006-113-H04         
AK060428            
AK098877            
AK098893            
AK121587            
D38231              
J013001E12          
J013001N15          
J013098G22          
J023004P15          
J023013D12          
J023014D09          
J023020G09          
J023034A19          
J023050I11          
J023079D13          
J023091B11          
J023099M03          
J023101H20          
J023106P14          
J023111F19          
J023132C22          
J023139O03          
J023146O10          
J033022G16          
J033030C10          
J033032G18          
J033034N09          
J033037K24          
J033038B22          
J033061E06          
J033065F08          
J033065I24          
J033069L01          
J033086N21          
J033102I06          
J033111N07          
J033113P12          
J033118K11          
J033125D08          
J033129P22          
J033131L12          
J033139D08          
J033141J08          
J043024B14          
J053048G19          
J065082C15          
J065087D24          
J065128P13          
J065135G03          
J065149I19          
J065154E16          
J065166H09          
J065194I16          
J065213M20          
J075020F19          
J075051J16          
J075093C18          
J075119H02          
J075120J11          
J075173A15          
J080302B05          
J080304G10          
J080305E13          
J080308A02          
J080310H10          
J080315L11          
J090005H15          
J090021C24          
J090025H24          
J090026C22          
J090027H15          
J090034B17          
J090045G11          
J090048H02          
J090052I06          
J090053G09          
J090054L17          
J090060M22          
J090075N17          
J090079K13          
J090086H08          
J090094N20          
J100021F03          
J100031M01          
J100033I18          
J100034P07          
J100043M16          
J100046J12          
J100055F09          
J100057D19          
J100060O10          
J100064G09          
J100065E24          
J100076M10          
J100077F24          
J100080E12          
J100089J04          
TSS from cDNA
TSS information
J090051N04                       5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J090051N04

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone+30086646-97
TSS clone peakGclone+30086651-92
TSS cloneCclone+30086674-69

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxGGTATAAAAG+3008661530086624-128-119
Y PatchTCTCTCCCC+3008666030086668-83-75
Y PatchTCCTCCCC+3008668830086695-55-48
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTAGGCCCATAC+3008641730086427-326-316
 OsREG656TAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG474 AGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG630  GGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG606   GCCCATAC PPDB MotifGCCCA  PLACE Motif 
REGAATGGGCTGC+3008644730086456-296-287
 OsREG432AATGGGCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG491 ATGGGCTG  PPDB MotifGCCCA  PLACE Motif 
 OsREG591  TGGGCTGC PPDB MotifGCCCA  PLACE Motif 
REGGGATGGGCTTA+3008647530086485-268-258
 OsREG608GGATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG466 GATGGGCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG429  ATGGGCTT  PPDB MotifGCCCA  PLACE Motif 
 OsREG655   TGGGCTTA PPDB MotifGCCCA  PLACE Motif 
REGGCAGCCCATTT+3008649130086501-252-242
 OsREG591GCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG491 CAGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG432  AGCCCATT  PPDB MotifGCCCA  PLACE Motif 
 OsREG422   GCCCATTT PPDB MotifGCCCA  PLACE Motif 
REGGGACGGCCCAAAT+3008650630086518-237-225
 OsREG624GGACGGCC      PPDB Motif  PLACE Motif 
 OsREG584 GACGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG445  ACGGCCCA    PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG563   CGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG625    GGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG493     GCCCAAAT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.