version
PlantPromoterDB promoter information of J090053E06

Summary of Gene (J090053E06)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0392801        NCBI 
Gene model J090053E06  
Description NONE  
#
#

Overview

Focused view (chromosome 5: 19120776-19121975)

Genome position     
from initiation codon
J090025K15          
TSS from cDNA
TSS information
J090053E06                       5'->3' (+)
Promoter sequence














 
                    
Os05g0392901        
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J090053E06

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+19121330-446

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCTCTT+1912129019121297-486-479
Y PatchTCTCTCTCTTTC+1912131819121329-458-447
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAGCCCATT+1912105619121063-720-713
 OsREG432AGCCCATT PPDB MotifGCCCA  PLACE Motif 
REGGTCCCTCA+1912110219121109-674-667
 OsREG652GTCCCTCA PPDB MotifGGGACCC  PLACE Motif 
REGACGTGGCG+1912122719121234-549-542
 OsREG448ACGTGGCG PPDB MotifACGT  PLACE MotifACGTGKC 
REGGTGGGACCCACGTGGGCCCCACGT+1912124619121269-530-507
 OsREG650GTGGGACC                 PPDB MotifGGGACCC  PLACE Motif 
 OsREG648 TGGGACCC                PPDB MotifGGGACCC  PLACE Motif 
 OsREG637  GGGACCCA               PPDB MotifGGGACCC  PLACE Motif 
 OsREG622   GGACCCAC              PPDB MotifGGGACCC  PLACE Motif 
 OsREG508      CCCACGTGGG         PPDB MotifACGT  PLACE Motif 
 OsREG449         ACGTGGGC        PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 
 OsREG571          CGTGGGCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG640           GTGGGCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG647            TGGGCCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG641             GGGCCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG631              GGCCCCAC   PPDB Motif  PLACE Motif 
 OsREG572               GCCCCACG  PPDB Motif  PLACE Motif 
 OsREG450                CCCCACGT PPDB MotifACGT  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.