version
PlantPromoterDB promoter information of J090054B01

Summary of Gene (J090054B01)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0601800        NCBI 
Gene model J090054B01  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 24412501-24411302)

Genome position     
from initiation codon
AB060276            
AK099539            
AK101873            
AK106801            
AK121758            
AK121891            
J013059H01          
J013092F08          
J013146J04          
J023001K12          
J023002H16          
J023013B10          
J023081I22          
J023084K19          
J023150E24          
J033023B18          
J033025F18          
J033048P08          
J033060M24          
J033070G06          
J033088P12          
J033105C13          
J043009N18          
J065103G21          
J075039H15          
J090014K10          
J090022N02          
J090033F18          
J090033I04          
J090041F11          
J090045P20          
J090055M12          
J090071K09          
J090098O16          
J090099P15          
J100050I16          
TSS from cDNA
TSS information
J090054B01                       5'->3' (-)
Promoter sequence











 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J090054B01

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-24412241-740

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCGCCTATAAATA-2441226724412278-766-777
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGACGGCCCGGATCCGACCCGC-2441229024412310-789-809
 OsREG584GACGGCCC              PPDB MotifGCCCA  PLACE Motif 
 OsREG446 ACGGCCCG             PPDB MotifACGGGC  PLACE Motif 
 OsREG544  CGGCCCGG            PPDB Motif  PLACE Motif 
 OsREG633   GGCCCGGA           PPDB Motif  PLACE Motif 
 OsREG588         GATCCGAC     PPDB MotifCCGAC  PLACE Motif 
 OsREG552             CGACCCGC PPDB Motif  PLACE Motif 
REGGTCCGTCCGATC-2441232224412333-821-832
 OsREG623GTCCGTCC     PPDB Motif  PLACE Motif 
 OsREG561 TCCGTCCG    PPDB Motif  PLACE Motif 
 OsREG545  CCGTCCGA   PPDB Motif  PLACE Motif 
 OsREG484   CGTCCGAT  PPDB Motif  PLACE Motif 
 OsREG589    GTCCGATC PPDB Motif  PLACE Motif 
REGTCGGCCCGGGTGGGGCCCACGCCCAGAT-2441234424412371-843-870
 OsREG568TCGGCCCG                     PPDB MotifACGGGC  PLACE Motif 
 OsREG544 CGGCCCGG                    PPDB Motif  PLACE Motif 
 OsREG539  GGCCCGGG                   PPDB Motif  PLACE Motif 
 OsREG528      CGGGTGGG               PPDB MotifGCCCA  PLACE Motif 
 OsREG612        GGTGGGGC             PPDB Motif  PLACE Motif 
 OsREG631         GTGGGGCC            PPDB Motif  PLACE Motif 
 OsREG641          TGGGGCCC           PPDB MotifGCCCA  PLACE Motif 
 OsREG647           GGGGCCCA          PPDB MotifGCCCA  PLACE Motif 
 OsREG640            GGGCCCAC         PPDB MotifGCCCA  PLACE Motif 
 OsREG571             GGCCCACG        PPDB MotifGCCCA  PLACE Motif 
 OsREG602              GCCCACGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG486                    GCCCAGAT PPDB MotifGCCCA  PLACE Motif 
REGCACGTCAC-2441237324412380-872-879
 OsREG505CACGTCAC PPDB MotifACGT  PLACE MotifTGAC 
REGGGCCCCACACG-2441245424412464-953-963
 OsREG631GGCCCCAC    PPDB Motif  PLACE Motif 
 OsREG611 GCCCCACA   PPDB Motif  PLACE Motif 
 OsREG535  CCCCACAC  PPDB Motif  PLACE Motif 
 OsREG526   CCCACACG PPDB MotifGCCCA  PLACE Motif 
REGCACTGACAGGTGG-2441248024412492-979-991
 OsREG510CACTGACA      PPDB Motif  PLACE MotifTGAC 
 OsREG453 ACTGACAG     PPDB Motif  PLACE MotifTGAC 
 OsREG551  CTGACAGG    PPDB Motif  PLACE MotifTGAC 
 OsREG501    GACAGGTG  PPDB Motif  PLACE Motif 
 OsREG436     ACAGGTGG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.