version
PlantPromoterDB promoter information of J090054H10

Summary of Gene (J090054H10)

Organism Oryza sativa  
Chromosome 8  
Locus Os08g0138500        NCBI 
Gene model J090054H10  
Description NONE  
#
#

Overview

Focused view (chromosome 8: 2151445-2150246)

Genome position     
from initiation codon
009-178-A03         
AK102951            
AY224458            
J033115D14          
J065013F04          
J065050P11          
J065063K18          
J065169E03          
J100083F11          
TSS from cDNA
TSS information
J090054H10                       5'->3' (-)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J090054H10

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-2150529-84

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGTGGGCCCCACCTGTCATCCACC-21505752150598-130-153
 OsREG628GGTGGGCC                 PPDB MotifGCCCA  PLACE Motif 
 OsREG640 GTGGGCCC                PPDB MotifGCCCA  PLACE Motif 
 OsREG647  TGGGCCCC               PPDB MotifGCCCA  PLACE Motif 
 OsREG641   GGGCCCCA              PPDB MotifGCCCA  PLACE Motif 
 OsREG631    GGCCCCAC             PPDB Motif  PLACE Motif 
 OsREG612     GCCCCACC            PPDB Motif  PLACE Motif 
 OsREG514       CCCACCTG          PPDB MotifGCCCA  PLACE Motif 
 OsREG436        CCACCTGT         PPDB Motif  PLACE Motif 
 OsREG501         CACCTGTC        PPDB Motif  PLACE Motif 
 OsREG515                CATCCACC PPDB Motif  PLACE Motif 
REGGAGACGCG-21506212150628-176-183
 OsREG560GAGACGCG PPDB Motif  PLACE Motif 
REGCCCATCCA-21506542150661-209-216
 OsREG534CCCATCCA PPDB MotifGCCCA  PLACE Motif 
REGGCCCCCACACGCCCACCT-21506702150687-225-242
 OsREG613GCCCCCAC           PPDB Motif  PLACE Motif 
 OsREG535  CCCCACAC         PPDB Motif  PLACE Motif 
 OsREG526   CCCACACG        PPDB MotifGCCCA  PLACE Motif 
 OsREG476          GCCCACCT PPDB MotifGCCCA  PLACE Motif 
REGCACGTGGCGCCACGT-21507002150714-255-269
 OsREG507CACGTGGC        PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG448 ACGTGGCGCCACGT PPDB MotifACGT  PLACE MotifACGTGKC 
REGTCTGGACC-21507182150725-273-280
 OsREG649TCTGGACC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.