version
PlantPromoterDB promoter information of J090057G17

Summary of Gene (J090057G17)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0679300        NCBI 
Gene model J090057G17  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 29423673-29424872)

Genome position     
from initiation codon
AK065079            
AK099229            
J013001K24          
J013028E14          
J013033F05          
J013049N18          
J013071C14          
J013088P15          
J013092D24          
J013093O14          
J023095E17          
J043005E21          
J043015E06          
J043027P22          
J065038B15          
J065073M21          
J065165P06          
J065198I06          
J100029K23          
J100086O16          
J100087M02          
TSS from cDNA
TSS information
J090057G17                       5'->3' (+)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J090057G17

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+29424585-88

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxATATAAACG+2942455229424560-121-113
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCCACGTGT+2942438829424396-285-277
 OsREG507GCCACGTG  PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG434 CCACGTGT PPDB MotifACGT  PLACE Motif 
REGCAGGTGGGTCCCA+2942449329424505-180-168
 OsREG514CAGGTGGG      PPDB MotifGCCCA  PLACE Motif 
 OsREG622   GTGGGTCC   PPDB MotifGGGACCC  PLACE Motif 
 OsREG637    TGGGTCCC  PPDB MotifGGGACCC  PLACE Motif 
 OsREG648     GGGTCCCA PPDB MotifGGGACCC  PLACE Motif 
REGCACTGACATGTGGGCCCCACA+2942452129424541-152-132
 OsREG510CACTGACA              PPDB Motif  PLACE MotifTGAC 
 OsREG627        TGTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG640         GTGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG647          TGGGCCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG641           GGGCCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG631            GGCCCCAC  PPDB Motif  PLACE Motif 
 OsREG611             GCCCCACA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.