version
PlantPromoterDB promoter information of J090058L14

Summary of Gene (J090058L14)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0915800        NCBI 
Gene model J090058L14  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 41673304-41672105)

Genome position     
from initiation codon
AK103859            
J090051E20          
J090056H03          
J090058P16          
J090076C19          
J100086P14          
TSS from cDNA
TSS information
J090058L14                       5'->3' (-)
Promoter sequence












 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J090058L14

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-41672317-13

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTAGGCCCACGCG-4167237941672390-75-86
 OsREG656TAGGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG472 AGGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG571  GGCCCACG   PPDB MotifGCCCA  PLACE Motif 
 OsREG602   GCCCACGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG530    CCCACGCG PPDB MotifGCCCA  PLACE Motif 
REGAAATGGGCCTC-4167239941672409-95-105
 OsREG422AAATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG431 AATGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG474  ATGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG587   TGGGCCTC PPDB MotifGCCCA  PLACE Motif 
REGTTTTGGGCCGGGCCCAAAC-4167241341672431-109-127
 OsREG592TTTTGGGC            PPDB MotifGCCCA  PLACE Motif 
 OsREG563  TTGGGCCG          PPDB MotifGCCCA  PLACE Motif 
 OsREG542   TGGGCCGG         PPDB MotifGCCCA  PLACE Motif 
 OsREG538    GGGCCGGG        PPDB MotifGCCCA  PLACE Motif 
 OsREG614     GGCCGGGC       PPDB Motif  PLACE Motif 
 OsREG616      GCCGGGCC      PPDB Motif  PLACE Motif 
 OsREG543       CCGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG566        CGGGCCCA    PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG639         GGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG625 TTTGGGCC GGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG593           GCCCAAAC PPDB MotifGCCCA  PLACE Motif 
REGAAAGCCCAAAA-4167245141672461-147-157
 OsREG421AAAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG426 AAGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG457  AGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG592   GCCCAAAA PPDB MotifGCCCA  PLACE Motif 
REGTACGGCCCAATA-4167247641672487-172-183
 OsREG645TACGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG445 ACGGCCCA    PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG563  CGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG492   GGCCCAAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG596    GCCCAATA PPDB MotifGCCCA  PLACE Motif 
REGTCAGGCCC-4167256741672574-263-270
 OsREG646TCAGGCCC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.