version
PlantPromoterDB promoter information of J090059G16

Summary of Gene (J090059G16)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0342900        NCBI 
Gene model J090059G16  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 12821763-12820564)

Genome position     
from initiation codon
006-032-D01         
006-033-E10         
006-037-G10         
006-039-F02         
006-051-G06         
006-053-E05         
006-056-B05         
006-058-F04         
006-059-E05         
006-060-F10         
006-104-D12         
009-129-C12         
AK060136            
AK060980            
AK064815            
AK104244            
AK104391            
AK104590            
AK104744            
AK106100            
J013000E10          
J023110A21          
J075027O22          
J075052J03          
J075066E15          
J075095C17          
J075118N05          
J075187K22          
J090026L04          
J100055P20          
J100062A10          
J100068G20          
TSS from cDNA
TSS information
J090059G16                       5'->3' (-)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J090059G16

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone-12820877-114
TSS clone peakCclone-12820874-111
TSS cloneTclone-12820873-110

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCTCCTATAAATA-1282090212820913-139-150
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGCCGTGG-1282091812820925-155-162
 OsREG521GGCCGTGG PPDB Motif  PLACE Motif 
REGCACGTGGGCCTC-1282093512820946-172-183
 OsREG508CACGTGGG     PPDB MotifACGT  PLACE Motif 
 OsREG449 ACGTGGGC    PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 
 OsREG571  CGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG472   GTGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG587    TGGGCCTC PPDB MotifGCCCA  PLACE Motif 
REGCCCGTGGGCCCCAC-1282097912820992-216-229
 OsREG531CCCGTGGG       PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG547 CCGTGGGC      PPDB MotifGCCCA  PLACE Motif 
 OsREG571  CGTGGGCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG640   GTGGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG647    TGGGCCCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG641     GGGCCCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG631      GGCCCCAC PPDB Motif  PLACE Motif 
REGCGCGTCGC-1282105912821066-296-303
 OsREG559CGCGTCGC PPDB Motif  PLACE MotifCGACG 
REGCTGGCCCACCTCGCCCCACG-1282106812821087-305-324
 OsREG577CTGGCCCA             PPDB MotifGCCCA  PLACE Motif 
 OsREG654 TGGCCCAC            PPDB MotifGCCCA  PLACE Motif 
 OsREG628  GGCCCACC           PPDB MotifGCCCA  PLACE Motif 
 OsREG476   GCCCACCT          PPDB MotifGCCCA  PLACE Motif 
 OsREG549        CCTCGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG572            GCCCCACG PPDB Motif  PLACE Motif 
REGCCTCGCCC-1282110612821113-343-350
 OsREG549CCTCGCCC PPDB MotifGCCCA  PLACE Motif 
REGAGGTGGGCCACCCCACGTG-1282111912821137-356-374
 OsREG476AGGTGGGC            PPDB MotifGCCCA  PLACE Motif 
 OsREG628 GGTGGGCC           PPDB MotifGCCCA  PLACE Motif 
 OsREG654  GTGGGCCA          PPDB MotifGCCCA  PLACE Motif 
 OsREG653   TGGGCCAC         PPDB MotifGCCCA  PLACE Motif 
 OsREG450          CCCCACGT  PPDB MotifACGT  PLACE Motif 
 OsREG508           CCCACGTG PPDB MotifACGT  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.