version
PlantPromoterDB promoter information of J090061J10

Summary of Gene (J090061J10)

Organism Oryza sativa  
Chromosome 8  
Locus Os08g0414300        NCBI 
Gene model J090061J10  
Description NONE  
#
#

Overview

Focused view (chromosome 8: 19891893-19893092)

Genome position     
from initiation codon
AK072217            
J065039C07          
J065098N11          
J065120J15          
J075076H12          
J075101N16          
J080010A07          
J080023C16          
J080027G22          
J080053D02          
J080065E17          
J080068C15          
TSS from cDNA
TSS information
J090061J10                       5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J090061J10

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+19892138-755

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCCTCCTCTCTCT+1989217019892184-723-709
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCACGTCAC+1989191219891919-981-974
 OsREG505CACGTCAC PPDB MotifACGT  PLACE MotifTGAC 
REGGCCACGTC+1989193019891937-963-956
 OsREG585GCCACGTC PPDB MotifACGT  PLACE MotifACGTGKC 
REGGCAGCCCACGA+1989194219891952-951-941
 OsREG591GCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG463  AGCCCACG  PPDB MotifGCCCA  PLACE Motif 
 OsREG601   GCCCACGA PPDB MotifGCCCA  PLACE Motif 
REGATGGCCCAGCC+1989195919891969-934-924
 OsREG487ATGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG578 TGGCCCAG   PPDB MotifGCCCA  PLACE Motif 
 OsREG620  GGCCCAGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG603   GCCCAGCC PPDB MotifGCCCA  PLACE Motif 
REGCCCCACACACC+1989201919892029-874-864
 OsREG535CCCCACAC    PPDB Motif  PLACE Motif 
 OsREG499   CACACACC PPDB Motif  PLACE Motif 
REGATCCGACGGCCCAGAT+1989203319892048-860-845
 OsREG483ATCCGACG         PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG546 TCCGACGG        PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG584    GACGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG445     ACGGCCCA    PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG565      CGGCCCAG   PPDB MotifGCCCA  PLACE Motif 
 OsREG629       GGCCCAGA  PPDB MotifGCCCA  PLACE Motif 
 OsREG486        GCCCAGAT PPDB MotifGCCCA  PLACE Motif 
REGCGCACCGC+1989206319892070-830-823
 OsREG554CGCACCGC PPDB Motif  PLACE Motif 
REGAGCCGTCCG+1989207919892087-814-806
 OsREG468AGCCGTCC  PPDB Motif  PLACE Motif 
 OsREG562 GCCGTCCG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.