version
PlantPromoterDB promoter information of J090068D17

Summary of Gene (J090068D17)

Organism Oryza sativa  
Chromosome 8  
Locus Os08g0359500        NCBI 
Gene model J090068D17  
Description NONE  
#
#

Overview

Focused view (chromosome 8: 16631614-16630415)

Genome position     
from initiation codon
003-107-F09         
006-070-F04         
006-080-E06         
006-091-E08         
006-096-E12         
006-111-F11         
009-090-H10         
014-013-B02         
014-083-E03         
014-100-F05         
AK104798            
AK112034            
J013060J18          
J033042C22          
J065168I06          
J075077E12          
J075094M21          
J100027E21          
J100058D21          
J100067B02          
TSS from cDNA
TSS information
J090068D17                       5'->3' (-)
Promoter sequence











 
                    
Os08g0359550        
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J090068D17

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-16630704-90
TSS clone peakAclone-16630697-83

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTCCTCTCC-1663071316630722-99-108
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCAAGCCCAGCCCATCCCCC-1663075816630777-144-163
 OsREG519CCAAGCCC             PPDB MotifGCCCA  PLACE Motif 
 OsREG496 CAAGCCCA            PPDB MotifGCCCA  PLACE Motif 
 OsREG428  AAGCCCAG           PPDB MotifGCCCA  PLACE Motif 
 OsREG464   AGCCCAGC          PPDB MotifGCCCA  PLACE Motif 
 OsREG603    GCCCAGCC         PPDB MotifGCCCA  PLACE Motif 
 OsREG533     CCCAGCCC        PPDB MotifGCCCA  PLACE Motif 
 OsREG523      CCAGCCCA       PPDB MotifGCCCA  PLACE Motif 
 OsREG491       CAGCCCAT      PPDB MotifGCCCA  PLACE Motif 
 OsREG466        AGCCCATC     PPDB MotifGCCCA  PLACE Motif 
 OsREG608         GCCCATCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG516            CATCCCCC PPDB Motif  PLACE Motif 
REGCAAGGCCCACGA-1663078616630797-172-183
 OsREG497CAAGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG430 AAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG472  AGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG571   GGCCCACG  PPDB MotifGCCCA  PLACE Motif 
 OsREG601    GCCCACGA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.