version
PlantPromoterDB promoter information of J090071J21

Summary of Gene (J090071J21)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0805900        NCBI 
Gene model J090071J21  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 35269876-35268677)

Genome position     
from initiation codon
AK073740            
J013068E03          
J033066K03          
J033092C14          
J065020G11          
J065098E16          
J065124L06          
J065134M23          
J065187M23          
J065208G07          
J075002G10          
J075004L01          
J075051K23          
J090063C03          
J100078K12          
TSS from cDNA
TSS information
J090071J21                       5'->3' (-)
Promoter sequence








 
AK072745            
J013130C06          
J013154L12          
J023135J07          
J065038E23          
J065042C10          
J090075B11          
J100033J17          
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence








 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J090071J21

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-35268968-92

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAGCCCACGGCCCACCT-3526901935269034-143-158
 OsREG463AGCCCACG         PPDB MotifGCCCA  PLACE Motif 
 OsREG547 GCCCACGG        PPDB MotifGCCCA  PLACE Motif 
 OsREG521   CCACGGCC      PPDB Motif  PLACE Motif 
 OsREG504    CACGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG445     ACGGCCCA    PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG564      CGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG628       GGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG476        GCCCACCT PPDB MotifGCCCA  PLACE Motif 
REGGCCCCCACAC-3526908935269098-213-222
 OsREG613GCCCCCAC   PPDB Motif  PLACE Motif 
 OsREG535  CCCCACAC PPDB Motif  PLACE Motif 
REGCGGATCGG-3526924835269255-372-379
 OsREG541CGGATCGG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakGclone+35269145AK072745, AK072745, J013130C06, J023135J07, J013154L12, J065038E23, J065042C10, J090075B11, J100033J17

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCATCCACC+3526887435268881AK072745, J013130C06, J013154L12, J023135J07, J065038E23, J065042C10, J090075B11, J100033J17
 OsREG515CATCCACC PPDB Motif  PLACE Motif 
REGAGGTGGGCCGTGGGCT+3526901935269034AK072745, J013130C06, J013154L12, J023135J07, J065038E23, J065042C10, J090075B11, J100033J17
 OsREG476AGGTGGGC         PPDB MotifGCCCA  PLACE Motif 
 OsREG628 GGTGGGCC        PPDB MotifGCCCA  PLACE Motif 
 OsREG564  GTGGGCCG       PPDB MotifGCCCA  PLACE Motif 
 OsREG445   TGGGCCGT      PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG504    GGGCCGTG     PPDB MotifGCCCA  PLACE Motif 
 OsREG521     GGCCGTGG    PPDB Motif  PLACE Motif 
 OsREG547       CCGTGGGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG463        CGTGGGCT PPDB MotifGCCCA  PLACE Motif 
REGGTGTGGGGGC+3526908935269098AK072745, J013130C06, J013154L12, J023135J07, J065038E23, J065042C10, J090075B11, J100033J17
 OsREG535GTGTGGGG   PPDB Motif  PLACE Motif 
 OsREG613  GTGGGGGC PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.