version
PlantPromoterDB promoter information of J090072I19

Summary of Gene (J090072I19)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0577000        NCBI 
Gene model J090072I19  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 21861033-21859834)

Genome position     
from initiation codon
006-057-G11         
006-091-F12         
006-104-D06         
006-118-H04         
012-055-F04         
016-023-G03         
AK061051            
AK099146            
J023061B16          
J033043G07          
J033105C05          
J065060A01          
J075020L04          
J075020M21          
J075079B17          
J075112N02          
J075133A13          
J075134K12          
J090048F23          
J100087C19          
J100090C21          
TSS from cDNA
TSS information
J090072I19                       5'->3' (-)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J090072I19

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone-21860158-125
TSS clone peakGclone-21860155-122

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCAGCTATATAAAG-2186018521860197-152-164
Y PatchTCCCCTCTC-2186013621860144-103-111
Y PatchTCCTCCTC-2186016421860171-131-138
Y PatchCTCCTCTCC-2186017321860181-140-148
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAGGGCCCAACCCGCGC-2186024521860260-212-227
 OsREG475AGGGCCCA         PPDB MotifGCCCA  PLACE Motif 
 OsREG639 GGGCCCAA        PPDB MotifGCCCA  PLACE Motif 
 OsREG626  GGCCCAAC       PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG595   GCCCAACC      PPDB MotifGCCCA  PLACE Motif 
 OsREG439        ACCCGCGC PPDB Motif  PLACE Motif 
REGAAAGCCCAATGGGCTTT-2186027321860289-240-256
 OsREG421AAAGCCCA TGGGCTTT PPDB MotifGCCCA  PLACE Motif 
 OsREG426 AAGCCCAA         PPDB MotifGCCCA  PLACE Motif 
 OsREG460  AGCCCAAT        PPDB MotifGCCCA  PLACE Motif 
 OsREG432       AATGGGCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG429        ATGGGCTT  PPDB MotifGCCCA  PLACE Motif 
REGCTTGGGCCTA-2186030621860315-273-282
 OsREG581CTTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG471 TTGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG656  TGGGCCTA PPDB MotifGCCCA  PLACE Motif 
REGTGGGGGAG-2186040021860407-367-374
 OsREG574TGGGGGAG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.