version
PlantPromoterDB promoter information of J090077B15

Summary of Gene (J090077B15)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0220600        NCBI 
Gene model J090077B15  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 6744277-6745476)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
J090077B15                       5'->3' (+)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J090077B15

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+6745992-235

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAGGCCCAACA+67457386745748-489-479
 OsREG430AAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG471 AGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG626  GGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG594   GCCCAACA PPDB MotifGCCCA  PLACE Motif 
REGAAGGCCCATTTCAGCCCAACA+67457596745779-468-448
 OsREG430AAGGCCCA              PPDB MotifGCCCA  PLACE Motif 
 OsREG474 AGGCCCAT             PPDB MotifGCCCA  PLACE Motif 
 OsREG431  GGCCCATT            PPDB MotifGCCCA  PLACE Motif 
 OsREG422   GCCCATTT           PPDB MotifGCCCA  PLACE Motif 
 OsREG657          TCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG511           CAGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG458            AGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG594             GCCCAACA PPDB MotifGCCCA  PLACE Motif 
REGGGCCCGTTACAGCCCAACA+67457986745816-429-411
 OsREG424GGCCCGTT            PPDB MotifAAACG(C/G), ACGGGC, CCAACGG  PLACE Motif 
 OsREG435        ACAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG511         CAGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG458          AGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG594           GCCCAACA PPDB MotifGCCCA  PLACE Motif 
REGGAGGCCCAGA+67458296745838-398-389
 OsREG587GAGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG473 AGGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG629  GGCCCAGA PPDB MotifGCCCA  PLACE Motif 
REGATCGGACGG+67458936745901-334-326
 OsREG484ATCGGACG  PPDB Motif  PLACE Motif 
 OsREG545 TCGGACGG PPDB Motif  PLACE Motif 
REGCTCGCGCG+67459116745918-316-309
 OsREG558CTCGCGCG PPDB MotifACGCGC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.