version
PlantPromoterDB promoter information of J090078H24

Summary of Gene (J090078H24)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0777950        NCBI 
Gene model J090078H24  
Description Conserved hypothetical protein.  
#
#

Overview

Focused view (chromosome 2: 33818439-33819638)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
J090078H24                       5'->3' (+)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J090078H24

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone+33819247-192

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGAGGGAC+3381899633819003-443-436
 OsREG652TGAGGGAC PPDB MotifGGGACCC  PLACE Motif 
REGTGAGGGAC+3381905733819064-382-375
 OsREG652TGAGGGAC PPDB MotifGGGACCC  PLACE Motif 
REGGTTTGGGCCCAAAT+3381910233819115-337-324
 OsREG593GTTTGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG639  TTGGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG625 TTTGGGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG493      GCCCAAAT PPDB MotifGCCCA  PLACE Motif 
REGAAACGGCCCATAA+3381912633819138-313-301
 OsREG420AAACGGCC      PPDB MotifAAACG(C/G)  PLACE Motif 
 OsREG423 AACGGCCC     PPDB MotifGCCCA, AAACG(C/G)  PLACE Motif 
 OsREG445  ACGGCCCA    PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG490   CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG630    GGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG605     GCCCATAA PPDB MotifGCCCA  PLACE Motif 
REGGTCCCTCA+3381918233819189-257-250
 OsREG652GTCCCTCA PPDB MotifGGGACCC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.