version
PlantPromoterDB promoter information of J090079B04

Summary of Gene (J090079B04)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0495000        NCBI 
Gene model J090079B04  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 19169239-19170438)

Genome position     
from initiation codon
015-070-F12         
015-094-G11         
016-063-D09         
AK060721            
AK073883            
AK119204            
J033071H20          
TSS from cDNA
TSS information
J090079B04                       5'->3' (+)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J090079B04

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+19170189-50

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCTCTCCTCTCCCCC+1917014019170155-99-84
Y PatchCTTCCTCC+1917021219170219-27-20
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTGGTGGGGGAG+1917002419170035-215-204
 OsREG527GTGGTGGG     PPDB MotifGCCCA  PLACE Motif 
 OsREG574    TGGGGGAG PPDB Motif  PLACE Motif 
REGCAGGTGGGC+1917004119170049-198-190
 OsREG514CAGGTGGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG476 AGGTGGGC PPDB MotifGCCCA  PLACE Motif 
REGCAAGTGGGGCCCACCT+1917006719170082-172-157
 OsREG498CAAGTGGG         PPDB MotifGCCCA  PLACE Motif 
 OsREG631   GTGGGGCC      PPDB Motif  PLACE Motif 
 OsREG641    TGGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG647     GGGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG640      GGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG628       GGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG476        GCCCACCT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.