version
PlantPromoterDB promoter information of J090079E24

Summary of Gene (J090079E24)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0186500        NCBI 
Gene model J090079E24  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 4817861-4816662)

Genome position     
from initiation codon
AK068056            
AK099031            
J013111A12          
J013127K13          
J013132O11          
J023056A11          
J023078M08          
J033081F07          
J090036F15          
J090097I02          
TSS from cDNA
TSS information
J090079E24                       5'->3' (-)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J090079E24

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-4817091-230

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCCCACGTGGG-48171514817161-290-300
 OsREG450CCCCACGT    PPDB MotifACGT  PLACE Motif 
 OsREG508 CCCACGTGGG PPDB MotifACGT  PLACE Motif 
REGCGCCACGTGTCCGACCCGC-48171784817196-317-335
 OsREG448CGCCACGT            PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG507 GCCACGTG           PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG434  CCACGTGT          PPDB MotifACGT  PLACE Motif 
 OsREG509   CACGTGTC         PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG451    ACGTGTCC        PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG552           CGACCCGC PPDB Motif  PLACE Motif 
REGAAACGGCCCACT-48172044817215-343-354
 OsREG420AAACGGCC     PPDB MotifAAACG(C/G)  PLACE Motif 
 OsREG423 AACGGCCC    PPDB MotifGCCCA, AAACG(C/G)  PLACE Motif 
 OsREG445  ACGGCCCA   PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG564   CGGCCCAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG478    GGCCCACT PPDB MotifGCCCA  PLACE Motif 
REGGCCCACAC-48172474817254-386-393
 OsREG598GCCCACAC PPDB MotifGCCCA  PLACE Motif 
REGGGGCCCCACC-48173614817370-500-509
 OsREG641GGGCCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG631 GGCCCCAC  PPDB Motif  PLACE Motif 
 OsREG612  GCCCCACC PPDB Motif  PLACE Motif 
REGCCACCAAC-48173774817384-516-523
 OsREG520CCACCAAC PPDB MotifCCAACGG  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.